What does DNA do
Carries the instructions for making proteins
How many bases does DNA have
4 bases A T C G
Where does DNA stay
DNA stays in the nucleus
Where is Protein assembled
In the ribosome
What does MRNA take from the DNA
MRNA takes the code from the DNA out of the nucleus
What does TRNA do in the ribosome
At the ribosome TRNA with its attached amino acid pairs up with the MRNA
What is the amino acid chain called
The amino acid is called a protein
How many genes does chromosomes have
They have a 1000 genes
What are chromosomes made out of
They are made out of DNA
Can hormones turn reproductive cells on or off
Yes they can turn reproductive cells on or off
Why does cells specialize/differentiate
The reason the cells specialize/differentiate because some genes are turned on/off
What is selective breeding
Humans choosing organisms to mate in order to get the desired traits in offspring
How can we make recombinant DNA
It can be made by cutting the DNA using special Enzymes and inserting genes into another organisms DNA
What is Gel electrophoresis
Fragments of DNA can be separated by size (small one goes through the gel faster then the larger ones
What is the difference between MRNA and DNA
1) DNA is a shaped into a double helix so it has double strands of nucleotides whereas RNA is a single strand of nucleotides
2)DNA Is “DEOXY”ribonucleic acid and RNA is ribonucleic acid – DNA uses dexoyribose sugar and RNA uses ribose sugar in its strucutre
3) The nucleotides for DNA is A,T,G,C but there is no T in RNA – instead there is URACIL (U)
look at this strand of nucleotides – is this RNA or DNA?
ATGCTACGGGGGCCAAATCGC
DNA
look at this strand of nucleotides – is this RNA or DNA?
AGCGCAAUUCCCGUACG
RNA
front: there are three type of RNA? what are the types, their location, their function?
back: mRNA – made in nucleus, moves to cytoplasm – function is TRANSCRIPTION
tRNA – made in nucleus, moves to cytoplasm – function is TRANSLATION
rRNA – part of the ribosome – helps in assembly of proteins because it is a structural part of ribosomes
front: Where are proteins ASSEMBLED in the cell? (by which organelle)
RIBOSOMES ARE THE LOCATION OF PROTEIN ASSEMBLY
If you have a DNA strand that looks like:
ATTGGCGCTAAT
what would the corresponding mRNA look like?
back: AUUGGCGCUAAU
remember mRNA is a COPY of the DNA strand
What is the role of RNA in protein synthesis?
The order of nucleobases in an mRNA strand (messenger RNA) correlate to a specifc sequences on tRNA (transfer RNA) which hold amino acids. As mRNA and tRNA join together, the amino acids of the tRNA bond together to form a polypeptide chain. mRNA is used as the instruction manual for how to assemble the amino acid order in order to create that specific protein