Basics of transcription (all life forms), transcription by bacteriophage T7 RNA polymerase and transcription by bacterial RNA polymerase (Escherichia coli) Flashcards Preview

BS2091 Biochemistry I: from genes to proteins > Basics of transcription (all life forms), transcription by bacteriophage T7 RNA polymerase and transcription by bacterial RNA polymerase (Escherichia coli) > Flashcards

Flashcards in Basics of transcription (all life forms), transcription by bacteriophage T7 RNA polymerase and transcription by bacterial RNA polymerase (Escherichia coli) Deck (67):
1

Give examples of gene regulation in humans

- The human body develops from a single cell in 9 months!
- Cancer involves gene de-regulation
- Stem cells have most of their genes “accessible” to them

2

Give an example of gene regulation in prokaryotes

A bacterium makes different enzymes depending on food available (lactose, glucose, amino acids etc.)

3

Bacteria and humans have a common ancestor that lived how many years ago (based on rRNA sequencing)?

~4 billion years ago
(Pace 1997)

4

Why study regulation of gene expression in bacteria?

- Model systems in research. Discovery of DNA as the material of genes, the genetic code. gene regulation etc.
- Vectors for molecular cloning and protein purification
- Biofuels
-Antibiotics, diseases
(And many others)

5

What are the differences in transcription in prokaryotes and eukaryotes?

In prokaryotes:
- Transcription and translation are coupled
- DNA is accessible to RNA polymerase
- Genes are often combined into groups (operons). Thus, mRNAs are polycistronic
- mRNA has no introns (no splicing)

6

Do bacteria have histones?

NO!

7

Is the promoter the same as Shine-Dalgarno?

NO!

8

Is the terminator the same as the stop codon?

NO!

9

What percentage of the genomic DNA in bacteria is coding?

Almost 100%

10

What percentage of the genomic DNA in humans is coding?

Only 1%

11

Despite the differences, is the chemistry of transcription the same or different between prokaryotes and eukaryotes?

The same
(For the last 4 billion years!)

12

Despite the differences, is the chemistry of transcription the same or different between prokaryotes and eukaryotes?

The same
(For the last 4 billion years!)

13

What are the 3 steps of transcription (true for all forms of life)?

1. Initiation
2. Elongation
3. Termination

14

What are the substrates for transcription?

- NTPs: ATP (same as used for energy), GTP, UTP and CTP
- DNA

15

What does RNAP do the the RNA chain?

RNAP adds nucleotides to the 3' end of the RNA chain

16

What does RNAP stand for?

RNA polymerase

17

How can biochemists detect transcription (and study RNAPs)?

Using NTPs containing radioactive alpha phosphate, e.g. alphaP32-UTP
(The RNA backbone becomes radioactive!)

18

Does initiation of transcription require a primer?

No

19

What goes into transcription?

dsDNA and ribonucleoside triphosphates (NTPs)

20

What enzyme is used for transcription?

RNAP
(2 Mg2+ ions in the active site (1 Mg is from the NTP))

21

What comes out of transcription?

RNA and inorganic pirophosphate (PPi)

22

Outline the initiation step of transcription

1. RNAP binds to promoter sequence in one preferred direction
2. Promoter unwinding and formation of the transcription bubble
3. RNAP 'reads' at the template strand with its active site

23

What does the mRNA product retain at its 5' end?

The 'original' triphosphate

24

Outline the elongation step of transciption

RNA polymerase uses ribo-NTPs to add bases to the 3'-end of the mRNA

25

What is meant by processivity of RNAP?

Once started, RNAP is determined to finish its job

26

Outline the termination step of transcription

RNAP and mRNA dissociate from the DNA when RNAP encounters a terminator DNA sequence

27

Outline the termination step of transcription

RNAP and mRNA dissociate from the DNA when RNAP encounters a terminator DNA sequence

28

What is the simplest RNAP?

RNAP of the bacteriophage T7

29

What is a bacteriophage?

A virus that infects bacteria ("bacteria-eaters")

30

Can a phage replicate by itself?

No; it needs to hiack the bacterial gene-expression and replication machinery

31

How many genes does the genome of the T7 phage contain?

55

32

How many genes are required for 'independent life'?

At least 500

33

Why should we care about phages and phage RNA polymerases?

- Production of RNA and proteins in large amounts (for research and biotechnology)
- Model systems for studying genes (phage DNA is tiny and is very easy to purify in large amounts)
- Human mitochondria (and all eukaryotic mitochondria) have their own RNA polymerase related to phage RNAP!
- Phages as alternatives to antibiotics (“Phage Therapy”?), issue with antibiotic resistant bacteria

34

Why should we care about phages and phage RNA polymerases?

- Production of RNA and proteins in large amounts (for research and biotechnology)
- Model systems for studying genes (phage DNA is tiny and is very easy to purify in large amounts)
- Human mitochondria (and all eukaryotic mitochondria) have their own RNA polymerase related to phage RNAP!
- Phages as alternatives to antibiotics (“Phage Therapy”?), issue with antibiotic resistant bacteria

35

Outline the phage T7 life cycle

1. The phage adsorbs onto an E.coli cell
2. The phage injects its DNA into the cell
3. The phage uses the bacterial RNAP and bacterial ribosomes express phage’s early genes, one of which is the gene that encodes for phage RNAP
4. Phage RNAP transcribes late genes
5. Bacterial ribosomes translate mRNA for phage DNA replication and structure
6. Phage particles get replicated and assembled
7. The cell explodes

36

Outline the phage T7 life cycle

1. The phage adsorbs onto an E.coli cell
2. The phage injects its DNA into the cell
3. The phage uses the bacterial RNAP and bacterial ribosomes express phage’s early genes, one of which is the gene that encodes for phage RNAP
4. Phage RNAP transcribes late genes
5. Bacterial ribosomes translate mRNA for phage DNA replication and structure
6. Phage particles get replicated and assembled
7. The cell explodes

37

What is the phage's ultimate goal? And what does this strategy require?

To hijack the bacterial cell's gene expression machinery, and to replicate as quickly as possible
This strategy requires the simplest form of gene regulation that involves switching from one type of RNAP to another:
- Use the bacterial RNAP and bacterial ribosomes to make the phage RNAP
- Use the phage RNAP and bacterial ribosomes to express the phage parts

38

What is the phage's ultimate goal? And what does this strategy require?

To hijack the bacterial cell's gene expression machinery, and to replicate as quickly as possible
This strategy requires the simplest form of gene regulation that involves switching from one type of RNAP to another:
- Use the bacterial RNAP and bacterial ribosomes to make the phage RNAP
- Use the phage RNAP and bacterial ribosomes to express the phage parts

39

How long does it take the fastest infectious organism in the world (the phage) to explode a cell?

~20 minutes
(Gene expression and gene regulation take time)

40

How many polypeptide chains is phage RNAP comprised of?

Only one!:
4 domains (NOT SUBUNITS!)
100 kD Mw

41

What part of the genome is recognised by T7 RNAP?

The promoter sequence

42

In terms of finding the 'consensus promoter' for RNAP, all sequences of T7 'late genes' look very similar between what?

-17 and +5

43

What is a consensus promoter sequence like?

A stereotypical person - it has traits (bases) from all promoters pooled together into one.
Every given promoter will be somewhat different from the consensus, just like every given person does not fit all stereotypes

44

What is the final consensus sequence that is used in all T7-based applications?

-17: TAATACGACTCACTATAGGGAGA

45

Outline the formation of the 'closed complex'

T7 RNAP recognizes the major groove of promoter upstream from +1
The promoter sequence between -1 and -12 is 'read' by the N-terminal domain

46

Outline the phage T7 life cycle

1. The phage adsorbs onto an E.coli cell
2. The phage injects its DNA into the cell
3. The phage uses the bacterial RNAP and bacterial ribosomes express phage’s early genes, one of which is the gene that encodes for phage RNAP
4. Phage RNAP transcribes late genes
5. Bacterial ribosomes translate mRNA for phage DNA replication and structure
6. Phage particles get replicated and assembled
7. The cell explodes

47

Outline the formation of the 'closed complex'

T7 RNAP recognizes the major groove of promoter upstream from +1
The promoter sequence between -1 and -12 is 'read' by the N-terminal domain

48

Outline the formation of the 'open complex'

RNAP bends and twists the DNA
The template strand dives into the active site next to the Mg+2 ion
The non-template strand
remains outside
The bubble spans from -5 to +5 (one turn of DNA helix)

49

When does promoter escape and elongation by T7 RNAP occur?

When the nascent RNA reaches the length of ~9 nucleotides

50

Describe the stability of the RNAP-DNA-RNA complex during elongation

The DNA-RNA-protein ternary complex is very stable due to an 'RNA exit channel' formed by the N-terminal domain!

51

What are very common features of enzymes that are processive?

Rings and tunnels

52

What is the remarkable initiation speed of the T7 RNAP?

The next RNAP molecule initiates as soon as the previous one clears the promoter: ~3 times per second

53

What is the remarkable elongation speed by the T7 RNAP?

300 nucleotides per second
RNAP also must spin at 30 revolutions per second = 1800 rpm (like a car engine rpm)

54

Phage RNAP is self-sufficient, simple, fast, and does not need much regulation. This is consistent with what?

Simple lifestyles of phages

55

What are the differences in transcription in prokaryotes and eukaryotes?

In prokaryotes:
- Transcription and translation are coupled
- DNA is accessible to RNA polymerase
- Genes are often combined into groups (operons). Thus, mRNAs are polycistronic
- mRNA has no introns (no splicing/capping/polyA)

56

What are the 3 steps of transcription (true for all forms of life)?

1. Initiation
2. Elongation
3. Termination

57

What enzyme is used for transcription?

RNAP
(2 Mg2+ ions in the active site (1 Mg is from the NTP) and aspartates)

58

What comes out of transcription?

RNA and inorganic pirophosphate (PPi)
(alpha, beta and gamma phosphates)

59

How many polypeptide chains is phage RNAP comprised of?

Only one!:
4 domains (NOT SUBUNITS!): (N-terminal, thumb, palm, fingers)
100 kD Mw

60

Phage RNAP is self-sufficient, simple, fast, and does not need much regulation. This is consistent with what?

Simple lifestyles of phages

61

How much slower are bacterial and eukaryotic RNAPs in initiation and elongation? And what does this reflect?

10-1000 times slower
Reflects their need for regulation

62

Describe some of the applications of T7 RNAP

- Model system to (very) basic mechanisms of transcription
- Production of RNA and proteins:
How to hire T7 RNAP to express a protein for you
The promoter sequence from -17 to +3
The sequence of the terminator, or run-off
Translation, initiation and termination elements in the mRNA
(Sometimes, 90% of the entire bacterial protein is ‘yours’!)

63

In what direction does transcription occur?

5' to 3'

64

What are the single strands of DNA called during transcription?

The non-template strand and the template strand

65

What genes are used for the transcription by bacterial RNAP?

Early genes

66

What genes are used for transcription by the phage T7 RNAP?

Late genes

67

Does the phage T7 RNAP undergo regulation?

NOT MUCH