Chapter 10

Question 1

Which of the following is NOT a key characteristic that genetic material must possess?

a. Genetic material must contain complex information.
b. Genetic material must replicate faithfully.
c. Genetic material must encode the phenotype.
d. Genetic material must have the capacity to vary.
e. Genetic material must contain nitrogen but not sulfur.

Answer 1

e. Genetic material must contain nitrogen but not sulfur.

Question 2

Why was the idea that genes are made of nucleic acids not widely accepted until after 1950?

a. Proteins are more abundant than nucleic acids, so it seemed more logical that proteins would carry genetic information.
b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.
c. Amino acids existed in the pre-biotic environment, so they would have most likely been the first to carry genetic information for life.
d. DNA was not chemically stable for long enough to be a good method of storing genetic information.
e. Nothing was known about the chemistry of DNA until after 1950.

Answer 2

b. Until the structure of DNA was understood, how DNA could store and transmit genetic information was unclear.

Question 3

How did Albert Kossel contribute to our understanding of DNA?

a. Used X-ray diffraction to examine the structure of DNA
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

Answer 3

b. Determined that DNA contains four different nitrogenous bases

Question 4

How did Fred Griffith contribute to our understanding of DNA?

a. Used X-ray diffraction to examine the structure of DNA
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

Answer 4

e. Discovered “the transforming principle” that could genetically alter bacteria

Question 5

How did Avery, MacLeod, and McCarty contribute to our understanding of DNA?

a. Used X-ray diffraction to examine the structure of DNA
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

Answer 5

e. Discovered “the transforming principle” that could genetically alter bacteria

Question 6

How did Rosalind Franklin contribute to our understanding of DNA?

a. Used X-ray diffraction to show that the structure of DNA is helical
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

Answer 6

a. Used X-ray diffraction to show that the structure of DNA is helical

Question 7

How did Alfred Hershey and Martha Chase contribute to our understanding of DNA?

a. Used X-ray diffraction to examine the structure of DNA
b. Determined that DNA contains four different nitrogenous bases
c. Found that “the transforming principle” is destroyed by enzymes that hydrolyze DNA
d. Found that the phosphorus-containing components are the genetic material of phages
e. Discovered “the transforming principle” that could genetically alter bacteria

Answer 7

d. Found that the phosphorus-containing components are the genetic material of phages

Question 8

Indicate which of the following statements is FALSE.

a. Covalent bonds connect nucleotides in a strand; noncovalent interactions hold strands into a double-stranded structure.
b. Uracil is similar to thymine except that uracil lacks a methyl group on the carbon at position 5 on the carbon-nitrogen ring.
c. Frederick Griffith demonstrated that a transforming chemical from dead bacteria could change the genetic information of living bacteria.
d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.
e. The pyrimidine bases in nucleic acids are cytosine, thymine, and uracil.

Answer 8

d. Avery, MacLeod, and McCarty showed that DNA is the genetic information of cells and that RNA is the genetic information of viruses.

Question 9

Which hypothesis contributed to the idea that protein is the genetic material because, with its 20 different amino acids, protein structure could be highly variable?

a. Tetranucleotide hypothesis
b. Central dogma hypothesis
c. RNA world hypothesis
d. One gene-one enzyme hypothesis
e. Adaptor hypothesis

Answer 9

a. Tetranucleotide hypothesis

Question 10

The following table shows Chargaff’s data that demonstrates base composition of DNA from different biological sources.
Source    A        T        G          C
E. coli    26.0   23.9   24.9    25.2
Yeast     31.3    32.9   18.7      17.1
Sea 
urchin    32.8  32.1     17.7      18.4
Rat         28.6   28.4   21.4     21.5
Human  30.3   30.3   19.5      19.9

Which of the following is NOT a general conclusion that is supported by these data?

a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence.
b. The amount of adenine is always equal to the amount of thymine.
c. The amount of guanine is always equal to the amount of cytosine.
d. Although the ratio of A/T and G/C is the constant, relative amount of any particular base varies between species.
e. (A + G) / (T + C) = 1

Answer 10

a. DNA consists of a series of four-nucleotide units, each containing all four bases—ATGC—in a fixed sequence.

Question 11

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral DNA?

a. 14C
b. 15N
c. 18O
d. 32P
e. 35S

Answer 11

e. 35S

Question 12

Hershey and Chase determined whether DNA or protein was the genetic material in bacteriophages. What isotope did they use to label the viral protein?

a. 14C
b. 15N
c. 18O
d. 32P
e. 35S

Answer 12

e. 35S

Question 13

What is the difference in hydrogen bonding between A/T pairs versus G/C pairs?

a. A/T pairs have one more hydrogen bond than G/C pairs.
b. G/C pairs have one more hydrogen bond than A/T pairs.
c. A/T pairs have two more hydrogen bonds than G/C pairs.
d. G/C pairs have two more hydrogen bonds than A/T pairs.
e. G/C pairs have three more hydrogen bonds than A/T pairs.

Answer 13

b. G/C pairs have one more hydrogen bond than A/T pairs.

Question 14

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the highest temperature?

a. a.10% AT and 90% GC
b. b.30% AT and 70% GC
c. c.50% AT and 50% GC
d. d.70% AT and 30% GC
e. e.90% AT and 10% GC

Answer 14

a. a.10% AT and 90% GC

Question 15

Heat can disrupt hydrogen bonding between DNA strands. Which of the following DNA strands would denature at the lowest temperature?

a. 10% AT and 90% GC
b. 30% AT and 70% GC
c. 50% AT and 50% GC
d. 70% AT and 30% GC
e. 90% AT and 10% GC

Answer 15

e. 90% AT and 10% GC

Question 16

The concept that genetic information passes from DNA to RNA to protein is called the

a. central dogma.
b. nitrogenous base.
c. transforming principle.
d. polynucleotide strand.
e. reverse transcription.

Answer 16

a. central dogma.

Question 17

A molecule that consists of a nitrogenous base bonded to the 1′ carbon of a ribose or deoxyribose is a(n)

a. nucleoside.
b. hairpin.
c. isotope.
d. polynucleotide.
e. nucleotide.

Answer 17

a. nucleoside.

Question 18

The bonds that connect nucleotides in a single strand are called ____________ bonds.

a. phosphodiester
b. peptide
c. ionic
d. hydrogen
e. glycosidic

Answer 18

a. phosphodiester

Question 19

With respect to their 3′ and 5′ ends, the two polynucleotide chains of a double-stranded DNA molecule are

a. antiparallel.
b. isotopes.
c. methylated.
d. complementary.
e. nitrogenous.

Answer 19

a. antiparallel.

Question 20

Indicate which of the following statements is TRUE.

a. There are three phosphates between each sugar in a molecule of DNA.
b. A-, B-, and Z-form DNA are all right-handed helixes.
c. There are three hydrogen bonds between AT pairs.
d. Ribose sugars have a hydroxyl on the 2′ carbon.
e. All organisms contain DNA that is roughly 25% A, 25% T, 25% G, and 25%

Answer 20

d. Ribose sugars have a hydroxyl on the 2′ carbon.

Question 21

Which of the following is NOT characteristic of A-form DNA compared to B- or Z-form DNA?

a. Has right-handed helixes
b. Exists when less water is present
c. Is long and narrow
d. Has 50% purines, 50% pyrimidines

Answer 21

c. Is long and narrow

Question 22

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

a. 30%
b. 60%
c. 35%
d. 70%
e. 15%

Answer 22

a. 30%

Question 23

ADNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have?

a. 10
b. 15
c. 30
d. 35
e. 60

Answer 23

d. 35

Question 24

If the sequence of one strand of DNA is 5′-GCTAGCGTCG-3′, what is the sequence of the complementary strand?

a. 3′-GCTAGCGTCG-5′
b. 5′-GCTGCGATCG-3′
c. 3′-CGATCGCAGC-5′
d. 5′-CGATCGCAGC-3′
e. 5′-CGAUCGCAGC-3′

Answer 24

c. 3′-CGATCGCAGC-5′

Question 25

Which of the following would NOT necessarily be true for a DNA molecule?

a. A = T
b. C = G
c. A + G = C + T
d. A + C = G + T
e. A + T = G + C

Answer 25

e. A + T = G + C

Question 26

Which of the following is not an example of secondary structure in nucleic acids?

a. Hairpin
b. Stem
c. H-DNA
d. B-DNA
e. C-DNA

Answer 26

e. C-DNA

Question 27

What type of secondary structure is formed by the pairing of three strands of DNA?

a. A-DNA
b. B-DNA
c. C-DNA
d. H-DNA
e. Z-DNA

Answer 27

d. H-DNA

Question 28

Which of these sequences could form a hairpin?

a. 5′-GGGGTTTTCCCC-3′
b. 5′-AAAAAAAAAAAA-3′
c. 5′-ACACACACACAC-3′
d. 5′-TTTTTTCCCCCC-3′
e. 5′-GGGTTTGGGTTT-3′

Answer 28

a. 5′-GGGGTTTTCCCC-3′

Question 29

Which of the following is not a chemical or structural characteristic of RNA that is different from those of DNA?

a. The RNA sugar is ribose instead of deoxyribose.
b. RNA is usually a single-stranded molecule instead of a hydrogen-bonded double strand like DNA.
c. The bases in RNA include uracil instead of thymine.
d. RNA molecules are generally shorter in length than those of DNA macromolecules.
e. The 2′ carbon of ribose has an H, unlike the OH in that position of deoxyribose.

Answer 29

e. The 2′ carbon of ribose has an H, unlike the OH in that position of deoxyribose.

Question 30

How many hydrogen bonds will be involved in base pairing in a DNA molecule of 50 base pairs that contains 15 cytosine bases?

a. 45
b. 100
c. 115
d. 135
e. 150

Answer 30

c. 115

Question 31

List three characteristics required of genetic material. For each characteristic, indicate how the structure of DNA helps us to understand the characteristic.

Answer 31

Genetic material must have the capacity to contain enough information to encode all the functions of an organism. Because DNA molecules in cells normally are very long and because the four base pairs can occur in any sequence, DNA molecules are able to store a large amount of information in the form of the sequence of nucleotide base pairs.

Genetic material must have a mechanism to be copied accurately for reproduction. The double helix model of DNA suggested to Watson and Crick that DNA could be replicated by semiconservative replication. In this mechanism, the two strands of a parental molecule are separated, and each parental strand acts as a template to direct the synthesis of a new strand through complementary base pairing.

Genetic material must be able to encode variable phenotypes. Changes in the sequence of base pairs in DNA (mutations) allow for the existence of different versions of genes (alleles) that can encode alternative phenotypes.

Question 32

How did Chargaff’s rules contribute to Watson and Crick’s elucidation of the structure of DNA?

Answer 32

The rules suggested the base-pairing combinations of adenine with thymine and guanine with cytosine.

Question 33

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material? What technique helped them to distinguish between viral DNA and protein?

Answer 33

It distinguished between protein and DNA as genetic material in phages. It is the DNA that is used to produce new phages within host cells. Radioactive isotopes were used to distinguish between DNA and protein. They used radioactive 32P to label the viral DNA, and they used radioactive 35S to label the viral proteins.

Question 34

Draw the complementary strand to the following single-stranded DNA and label the 5′ and 3′ ends: 5′-ATAGCATGGGCCATACGATTACTGA-3′

Answer 34

3′-TATCGTACCCGGTATGCTAATGACT-5′

Question 35

How many of each of the following does this DNA molecule have?

AATAGCGGATGCCCGAATACGAG
TTATCGCCTACGGGCTTATGCTC

a. 3′ hydroxyls
b. Hydrogen bonds
c. Purines
d. Ribose sugars

Answer 35

a. 2
b. 58
c. 23
d. 0

Question 36

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template?

3′-TACCGTGCGTGACATTAAGCC-5′

Write the sequence from 5′ to 3′, left to right.

Answer 36

5′-ATGGCACGCACTGTAATTCGG-3′

Question 37

What would be the sequence of an RNA produced by using the DNA sequence shown as a template?

3′-TACCGTGCGTGACATTAAGCC-5′

Write the sequence from 5′ to 3′, left to right.

Answer 37

5′-AUGGCACGCACUGUAAUUCGG-3′