Module 3 Structure

Question 1

State 5 aims of the Human Genome project in sequencing the human genome.

Answer 1

• Identify all human genes and their roles
• Analyse genetic variation between people
• Sequence genomes from model organisms used in genetics
• Develop new sequencing techniques & computational analysis
• Share genome information with the public

Question 2

Name Four sources of variation in the human genome and outline the DNA changes they involve.

Answer 2

• Copy number variations (CNVs), are large areas of DNA >500bp that are present in different amounts person to person (large portions that have been duplicated or deleted compared to the human reference
  genome) .
• Short tandem repeats (STRs), are repeats of 2-5 nucleotides found in specific regions of the genome where the number of repeats varies.
• Insertions/deletions (InDels), small amounts of DNA that has either been inserted or deleted from the genome.
• Single nucleotide polymorphisms (SNPs) – single base-pair changes or variants in the genome.

Question 3

Copy number variations (CNVs), are

Answer 3

large areas of DNA >500bp that are present in different amounts person to person (large portions that have been duplicated or deleted compared to the human reference
genome).

Question 4

Short tandem repeats (STRs), are

Answer 4

repeats of 2-5 nucleotides found in specific regions of the genome where the number of repeats varies.

Question 5

Insertions/deletions (InDels)

Answer 5

small amounts of DNA that has either been inserted or deleted from the genome.

Question 6

Single nucleotide polymorphisms (SNPs) are

Answer 6

single base-pair changes or variants in the genome.

Question 7

State 6 reasons for analysing genetic variation in the human genome.

Answer 7

• Discover who you are related to
• Where (some of) your ancestors came from
• Muscle types
• Risks of disease
• Drug metabolism
• Crime solving etc.

Question 8

DNA sequences from the same gene for three different species are aligned below.

Sequence from species 1: ACGCGTCGTGATACTAGTACTACCCAAGTTGTTTTTAC
Sequence from species 2: ACGCGTCGTGAAACTAGTACTACCGAAGTTGAAATTAC
Sequence from species 3: ACGCGTCGTGGTACTAGTACTACGGAAGTTGTTTTTAC

How many differences are there between the sequences above:

Answer 8

• 1 and 2 = 5
• 1 and 3 = 3
• 2 and 3 = 6

Question 9

Assuming these species descend from a recent common ancestor, which TWO species are likely to be the most closely related?

Sequence from species 1: ACGCGTCGTGATACTAGTACTACCCAAGTTGTTTTTAC
Sequence from species 2: ACGCGTCGTGAAACTAGTACTACCGAAGTTGAAATTAC
Sequence from species 3: ACGCGTCGTGGTACTAGTACTACGGAAGTTGTTTTTAC

Answer 9

1 and 3

Question 10

Draw a phylogenetic tree of the relationship between these three species.

Sequence from species 1: ACGCGTCGTGATACTAGTACTACCCAAGTTGTTTTTAC
Sequence from species 2: ACGCGTCGTGAAACTAGTACTACCGAAGTTGAAATTAC
Sequence from species 3: ACGCGTCGTGGTACTAGTACTACGGAAGTTGTTTTTAC

Answer 10

L23

Question 11

Fragile X is likely to be dominant. Explain why

Answer 11

The disease is present in every single generation which suggests that there are no carriers for the disease, therefore dominant.

Question 12

The Fragile X gene is located on the X-chromosome. How does A dominant X-linked
disease explain the ratio of males to females we see in the pedigree?

Answer 12

More females than males have the disease.
Expect more females to have the disease than males, because females have two copies of the X chromosome and so have a chance of getting it from both of their parents whereas males only have one chromosome and so can only inherit the disorder from their mothers.

Question 13

Dominant X-linked disease.

Draw punnet squares between individual 1 and 2 and
individuals 6 and 7 to find the predicted percentage of affected female and male offspring.

1- affected male
2- normal female

6- Affected female
7- Normal male

Answer 13

An affected male (such as 1) has a 100% probability of passing to daughters and 0% probability of passing to sons.

An affected female (such as 6) has a 50% probability of passing it to either daughter or son.

Question 14

Explain why polygenic genetic disorders are usually probabilistic, not deterministic, and provide examples.

Answer 14

Most diseases arise through a combination of genetic variants (DNA changes), and interaction with the environment.

This means that having a disease-related variation does not mean that you will get the disease, therefore is probabilistic. (Compared with monogenic disorders which are often deterministic but much less common.)

Cancer, autism, liver disease, kidney disease, diabetes,
multiple sclerosis etc.

Question 15

The DNA code is “universal”. Explain what this means.

Answer 15

DNA code is the same across all organisms

DNA from any organism or even synthetic DNA can be
used by any other organism.

Question 16

A transgenic mouse contains foreign DNA within its genome.

Outline the technique used to create a transgenic mouse.

Answer 16

‘Foreign’ DNA (containing gene of interest) is injected into the male pronucleus of the fertilised mouse egg.
Eggs are then transplanted back into the female for embryos to develop, and a litter is born.
Successful transgenic mice contain an extra piece of DNA and can express the protein e.g. the transgenic jellyfish green fluorescent protein

Question 17

State 4 reasons that transgenic techniques might be useful.

Answer 17

• To understand how genes work / what a gene does.
• To engineer useful protein products (synthetic biology).
• For gene therapy approaches.
• To study the effect of making a foreign protein or of making a protein in the wrong cells.

Question 18

Within the Human Genome, potential disease genes can be found by looking for novel sequence variants, but this does not confirm whether a variant will cause disease.

Outline the general process used by modern genetics to determine whether a gene variant is pathogenic.

Answer 18

Damage (modify) the gene of interest by genetically modifying a model organism or cell line, then examine the
organism or its offspring to work out what the gene normally does (by observing what no longer works after the
gene has been damaged). E.g. using CRISPR/Cas9.

Question 19

During embryonic development, most cells become more differentiated and less plastic. Which two cell types constitute an exception to the rule?

Answer 19

Stem cells and Germ cells (eggs and sperm)

Question 20

Embryonic stem cells are

Answer 20

• Pluripotent and can give rise to all cell types (except placenta).
• Derived from inner cell mass (of the blastocyst)/embryo.

Question 21

Adult stem cells are

Answer 21

• Multipotent and can only give rise to one or a few cells types/are less flexible than
  embryonic stem cells.
• Found in adult tissue/renewal tissues/bone marrow.

Question 22

Explain why nuclei from the embryonic cells are more capable of producing viable cloned tadpoles than nuclei from intestinal cells.

Answer 22

Intestinal nuclei are differentiated/specialized/cannot normally reset itself to embryonic state/only make intestinal cells/only make one cell type.

Embryonic stem cells are pluripotent/can divide into all cell types required for the embryo

Question 23

How might scientists now be able to overcome the issue with transplanting nuclei from intestinal cells?

Answer 23

Create iPS (Induced pluripotent stem cells) by ‘reprogramming’ adult cells by genetic engineering.