biology final exam Flashcards
(58 cards)
Explain how cancer occurs.
Cancer occurs due to mutations in genes. The two types of tumors are benign (non-cancerous) and malignant (cancerous).
What are the differences in DNA and RNA?
DNA is double-stranded and uses thymine as a base. RNA is single-stranded and uses uracil.
What are the base pairing rules for DNA?
A-T
C-G
What are the base pairing rules for RNA?
A-U
C-G
What is mitosis?
Mitosis is the process of cell division that results in two identical daughter cells.
Describe what happens during mitosis.
Mitosis consists of several phases: prophase (chromosomes condense), metaphase (chromosomes align at the center), anaphase (sister chromatids separate), and telophase (nuclear membranes reform).
What happens if there is a mutation in a gene that regulates the cell cycle?
A mutation in a gene that regulates the cell cycle can lead to uncontrolled cell division, resulting in cancer.
What is meiosis?
Meiosis is a type of cell division that reduces the chromosome number by half, producing gametes for sexual reproduction.
What is crossing over?
Crossing over is the exchange of genetic material between homologous chromosomes during meiosis, increasing genetic diversity.
What is the result of mitosis and cytokinesis?
The result of mitosis and cytokinesis is two genetically identical daughter cells.
What are the base pairing rules in RNA?
In RNA, adenine pairs with uracil (A-U) and cytosine pairs with guanine (C-G).
What is a mutation?
A mutation is a change in the DNA sequence that can affect gene function.
What are the two purposes of the cell cycle?
The two purposes of the cell cycle are to enable cell growth and to ensure proper cell division.
Draw the steps of Mitosis.
Mitosis involves prophase, metaphase, anaphase, and telophase, resulting in two identical daughter cells.
What is transcription?
Transcription is the process of synthesizing RNA from a DNA template, occurring in the nucleus.
What is translation?
Translation is the process of synthesizing proteins from mRNA, occurring in the cytoplasm.
What are the names and functions of the 3 types of RNA?
The three types of RNA are mRNA (messenger RNA, carries genetic information), tRNA (transfer RNA, brings amino acids), and rRNA (ribosomal RNA, forms the core of ribosomes).
What is a codon?
A codon is a sequence of three nucleotides in mRNA that specifies an amino acid.
How many codon combinations are there?
There are 64 codon combinations, but only 20 different amino acids, leading to redundancy in the genetic code.
Do all cells in a single organism contain the same genetic information?
Yes, all cells in an organism contain the same genetic information, originating from a single fertilized egg.
Why do cells in the same organism look and act differently?
Cells look and act differently due to differential gene expression, where different genes are turned on or off.
What is a mutation? Are mutations beneficial or harmful?
A mutation is a change in the DNA sequence. Mutations can be beneficial, harmful, or neutral.
What are 3 types of mutations that can happen within a single gene?
The three types of mutations are substitution (one base is replaced), insertion (extra base is added), and deletion (base is removed). Each can affect the resulting protein and organism.
Replicate the DNA strand below.
The replicated strand of ATATACTTTGCGATGGCTATTCAGACT is TATATGAAACGCTACCGATAAGTCTGA. This occurs in the nucleus.