CRISPR LAB MANUAL

Question 1

CRISPR Gene editing in Yeast: GOAL = 5

Answer 1

1. To demonstrate the use of Clustered Regularly Interspersed Short Palindromic Repeats
   (CRISPR) to edit a gene from wild type to mutant in a Eukaryotic organism.
2. To demonstrate the concept of genetic engineering through gene editing.
3. To demonstrate the use of the fungal yeast species Saccharomyces cerevisiae as an experimental system for genetic analysis.
4. To incorporate what you have learned about sterile technique, pipetting, and lab safety into a genetics laboratory exercise involving a single cell eukaryote.
5. To introduce the concept of metabolic and developmental mutants in eukaryotic cell function and development

Question 2

CRISPR:

Answer 2

Clustered Regularly Interspersed Short Palindromic Repeats

Question 3

CRISPR: Clustered Regularly Interspersed Short Palindromic Repeats

WHAT IS IT?

Answer 3

1. CRISPR is a bacterial adaptive immune system that has been modified for genome engineering.
2. The name comes from repeating segments of DNA that are found in the genomes of prokaryote (bacterial) cells.
3. Each of the repeat sequences is followed by a
   unique “spacer” DNA sequence.
4. In 2005, it was discovered that the spacer sequences
   between the repeats are identical to bacteriophage DNA.

Question 4

Cas9 protein:

Answer 4

1. CRISPR Associated protein 9.
2. Cas proteins are encoded by genes associated with CRISPR sequences in the bacterial genome.
3. These are nuclease proteins needed to identify and cut the targeted DNA sequence.
4. The first Cas protein to have its activity characterized was Cas9 from Streptococcus pyogenes.
5. Cas9 is currently the preferred Cas protein used for CRISPR/Cas gene editing
   and is the protein that is used for this laboratory

Question 5

gRNA: 5

Answer 5

1. Guide RNA. This is also called crRNA (CRISPR targeting RNA).
2. In the bacterial genome, this is the transcribed region of the unique “spacer” sequences found in CRISPR regions.
3. The transcribed spacer region guides the Cas proteins to foreign genetic elements contained in the viral DNA genome.
4. The guide RNA for CRISPR gene editing is usually 20 nucleotides (nt) in length and corresponds to sequences within the target
   gene.
5. In this lab, CAS plasmids have a 20 nt guide RNA targeting the coding region of ADE2.

Question 6

pCAS9/guide RNA plasmid.

Answer 6

1. This is a cloning/expression plasmid vector that contains two genes relevant to CRISPR
   function.
2. First, it encodes the CAS9 protein. Second, it encodes the 20 nt guide RNA that
   targets the pCAS9 protein to the targeted gene.
3. When transformed into the host cells (in our case, the transformed yeast cells), the expressed CAS9 protein combines with the 20 nt guide RNA to form a targeted nuclease that will make a double stranded (ds) cut within the targeted gene.
4. ‘Note that since this plasmid must be grown in both prokaryotic E. coli, and
   eukaryotic yeast, it contains promoters and origins of replication for both types of cells.’
5. It also contains resistance genes for a selectable genetic marker in both E. coli and yeast cells.

Question 7

DS cut, or break:

Answer 7

1. A DS Break made in the targeted gene by the CAS9/guide RNA nuclease.
2. A break in both strands of the DNA double helix, caused by the gRNA guided Cas9 protein, that elicits a DNA repair mechanism called Homology Directed Repair (HDR)

Question 8

PAM:

Answer 8

1. Protospacer Adjacent Motif.
2. Specific DNA sequence that must follow the target DNA sequence in order for Cas9 to bind and cut DNA.
3. Cas9 from Streptococcus pyogenes, the protein for this lab, has a PAM
   sequence of NGG. Novel PAM sequences have been identified in other Cas-like protein systems.

Question 9

HDR:

Answer 9

1.Homology Directed Repair.

2. This is a DNA repair mechanism that uses DNA homology to repair a double stranded break (DSB).
3. This mechanism can be used to insert novel DNA sequences into a genome by
   flanking the desired sequence with DNA regions homologous to the sequences flanking an
   induced DSB.

Question 10

HDR template DNA.

Answer 10

1. A PCR amplified section of DNA, about 120 nt in length, that is used as a template to repair the dsDNA cut made by the CAS9/guide RNA within the targeted gene.
2. The HDR template
   usually has modified DNA sequences that are edited into the targeted gene when the gapepair process is completed.
3. In this lab, we have one HDR template designed to insert three in-frame stop codons into the ADE2 gene.
4. You will PCR amplify and purify the HDR template fragment which will be co-transferred along with the pCAS9/guide RNA plasmid

Question 11

Target DNA sequence

Answer 11

Genomic DNA targeted by the CRISPR/Cas9 system.

Typically, the target sequence is 20 nucleotides long, and must be immediately followed by the PAM sequence.

Question 12

ds,

Answer 12

double stranded

Question 13

nt

Answer 13

nucleotide

Question 14

bp

Answer 14

base pair

Question 15

DSB

Answer 15

double stranded break

Question 16

The CRISPR processes

Answer 16

For CRISPR gene editing in yeast, competent yeast cells are simultaneously transformed with
two DNA molecules:

The pCAS9 guide RNA plasmid, for the first step of the process, and an
HDR DNA template, for the second step of the process.

Question 17

The CRISPR processes step 1

Answer 17

1. The first step of the CRISPR process is using the CAS9-guide RNA complex to make an endonucleolytic double stranded cut within the targeted gene (the gene you want to edit).
2. When the pCAS9/ guide RNA plasmid is transformed into the yeast cells, it produces both the CAS9 protein and the appropriate guide RNA.
3. These interact to form the pCAS9-guide RNA ribonucleoprotein (RNP = RNA + protein) complex.
4. Within the cell nucleus, the CAS9-guide RNP recognises the genomic DNA sequence that
   corresponds to the guide RNA.
5. The complex, acting as an endonuclease, then cuts the DNA at that location. This produces a double stranded cut in the DNA. If the CAS9-guide RNA RNP is targeted to a specific DNA sequence within a gene, the cut will disrupt the gene sequence, which will then make the cut DNA available for repair by the host cell’s DNA repair
   mechanisms.

Question 18

The CRISPR processes step 2

Answer 18

1. 2. The second step of the CRISPR process is using a repair DNA template to introduce the edited gene sequence at the site of the double stranded DNA break
2. The HDR DNA template is transformed into the cells at the same time as the pCAS9/guide RNA plasmid.
3. The HDR repair template is between 120 bp – 150 bp and is homologous to the region that is being edited. It contains the same sequence as the guide RNA region, as well as the surrounding DNA regions.
4. It will contain almost all of the same sequence as the original gene, except that one or more edited nucleotides will be introduced into the sequence.

5.The HDR Fragment is inserted into the gene at the site of the original DNA break.

6. This occurs through the cell’s innate DNA repair machinery, which uses the HDR sequence as the model
   sequence to repair the broken DNA.
7. The entire DNA region, including and surrounding both sides of the DS break, are replaced with the DNA fragment from the HDR Fragment.

Question 19

The CRISPR processes step
3a

Answer 19

3A. The guide RNA sequence
Below is a line representing the yeast ADE2 gene, with a sequence near the 5’ end of the gene highlighted.

2. The ATG (AUG) start codon is highlighted in bold, and the encoded amino
   acids for this region of the gene are shown.
3. Note that some 5’ non-coding sequence is also
   shown.

4.It is very important to note the last three bases in the selected target sequence (underlined).

5. These are the Protospacer Adjacent Motif PAM). Any target sequence that is not followed by this three base sequence (NGG, where N = any base, and G = guanine bases) will not be
   recognized.
6. Therefore, if this sequence actually read ATTGGGACGTATGATTGTTGATG, it would not
   contain the NGG sequence, and would not be recognized by the CRISPR/guide RNA complex.
7. Any target sequence must end with a three base NGG PAM sequence, or it cannot be used.
8. The guide RNA sequence itself cannot contain the PAM sequence. Thus, the guide RNA for this sequence, identified by CRISPR direct, would be three bases shorter than the target sequence, with the PAM removed from the 3’ end.

9.The CAS9/guide RNA makes a DS endonucleolytic digest within the targeted DNA sequence,
resulting in a DSB in the DNA sequence.

Question 20

The CRISPR processes

step 3b

Answer 20

1. For any living cell, a double stranded break like this would naturally induce an endogenous
   DNA repair mechanism, which is known as Homology Directed Repair (HDR).

2.The HDR fragment that is produced is much larger than the guide RNA, it should extend at least 50 or so bases to either end of the guide RNA target. The repair fragment we will use for
the ADE2 gene is shown above.

3. Note from the diagram that the fragment is edited.
4. Some nucleotides within the gene have been altered to now contain early stop codons. There three
   edits to stop codons within the HDR fragment.
5. The edited HDR fragment will be used as a repair template by the host cells endogenous HDR
   process to repair and replace the original DNA surrounding the DSB in the ADE2 gene.
6. Since
   the HDR fragment has the edited stop codons, the repaired gene that has incorporated the HDR
   will now contain the three stop codons, which will inactivate the gene and cause a directed
   gene mutation.
7. It is important to note that the final stop codon edit has removed the PAM from the guide RNA target sequence in the HDR, and therefore in the edited gene after the HDR repair is complete.
8. Why is this important? Because, if the PAM is inserted back into the edited gene, the
   CAS9/guide RNA will still recognize this sequence as a target and will continue to cut the now
   edited gene at that location.
9. With the PAM sequence removed from the edited region, the
   CRISPR process will no longer work at this target site, and the gene edit will be preserved.
10. We have cloned the HDR into a plasmid called pUC57. For this lab, you will amplify the edited HDR fragment by PCR, using primers specific for each end of the HDR fragment, and then purify the PCR fragment for use in the yeast transformation protocol.
11. As stated above,
    the HDR and the pCAS9/guide RNA plasmid will be transformed together into the competent yeast cells.

Question 21

*Adenine2 (ADE2).

Answer 21

The ADE2 gene encodes the enzyme Phosphoribosylaminoimidazole Carboxylase.

This enzyme catalyses a step in the ‘de novo’ purine nucleotide biosynthetic
pathway.

In ade2 mutants, the cells are deprived of adenine and red pigment accumulates,
resulting in a pink phenotype.

Question 22

Yeast gene nomenclature

Answer 22

yeast genes are presented in all caps for the wild type, and in lower
case for the mutant. Thus, ADE2 is wild type, and ade2 is mutant. Gene names are italicized.

Note: For this lab, you will transform competent Sigma1278b yeast cells with either
pCAS9/guide RNA plasmids and HDR fragments or only pCAS9/guide RNA plasmids for the
ADE2 gene. Experiments will be performed by students in pairs as lab partners. Please work in
pairs and make sure to label all the tubes and plates.

Question 23

CRISPR experimental protocol

Answer 23

For this practical experiment, we will be editing ADE2 gene in the yeast Saccharomyces
cerevisiae strain Sigma1278b.