CST REVIEW Flashcards
(50 cards)
What are the 4 biomolecules?
Proteins, carbohydrates, lipids and nucleic acids
What is the name of the building blocks of a protein?
amino acids
What is the term used to describe the ability of a cell’s membrane to be selective in what goes in and out of a cell?
semipermeable
What is the main difference between a prokaryotic cell and a eukaryotic cell?
has a nucleus
what things do eukaryotic and prokaryotic cells have in common?
cytoplasm, cell membrane, DNA, ribosomes
What is the function of a ribosome?
to make proteins/protein synthesis/translation
What is the purpose of an enzyme?
to speed up the rate of a chemical reaction
What group of biomolecules does an enzyme belong to?
proteins
Which biomolecules are nonpolar and do not dissolve in water?
lipids
Why can antibiotics kill bacteria and not kill viruses?
Bacteria are cells that get in among our own cells and reproduce and the antibiotics can kill them without killing our cells. Viruses invade the cell and attach to the DNA so the only way to kill them is to kill the infected cell and our bodies do not know the difference between infected and noninfected cells.
What are the steps to making a protein?
DNA unwinds in nucleus
mRNA copies one side of the strand in process of transcription
mRNA leaves nucleus and enters cytoplasm
mRNA are then copied by tRNA for translation
Codon (group of 3) match with the RNA bringing amino acids to make chain to form a protein
Which parent’s chromosomes determines the sex of the human baby?
the father X or Y
mom can ONLY contribute an X
What is the process called when the fusion of gametes occurs, resulting in a new combination of alleles?
Fertilization
Why is reproduction NOT considered a necessary process for life?
Reproduction is not NECESSARY for life to maintain homeostasis. It is only necessary to keep the species going in the future.
What is the term used to describe the body when all things are working well and the organism is healthy?
Homeostasis
What are the steps to the scientific method?
What must be true for research to be accepted and become a law or theory?
Observation –> Research–> Hypothesis–> Experiment (data collection)–> Results–> Conclusions
The experiment must be duplicated many times before it can be accepted.
What is the biological heirarchy from smallest organisms to largest groups?
atom–> molecule–> biomolecules–> organelles–> cells–>tissues–> organs–> organ systems–> organism–> population–> community–> ecosystem–> biome–>
If a solution has a pH of 5.4 is it classified as an acid or a base?
acid
pH>7 = base
pH< 7 = acid
pH = 7 neutral (water)
Why does water make such a good solvent for a solution in living things?
It is POLAR and can dissolve things easily.
What are the 4 building blocks of DNA called?
Nucleotides
Guanine, Cytosine, Adenine and Thiamine
How many codons can the piece of mRNA code for?
UUAGCGAAAUCCGCGCUAAGUCGA
What would be the sequence of amino acid codons in the chain?

8 codons of 3
AAU CGC UUU AGG CGC GAU UCA GCU
What is the function of the golgi?
To package the materials the ER makes and ship them out in vesicles.
What are the organisms at the bottom of a food pyramid called?
producers
An organism that can produce its own food is called a _______________.
Autotroph
(Heterotrophs have to get their food from an outside source)