Exam 1 Bio Study Guide

Question 1

In rabbits, there is a gene that controls ear length, with a dominant allele “T” for long ears and a recessive allele “t” for short ears. At another gene locus, there are alleles “B” for black and “b” for white coats. Neither the B or b allele is dominant and Bb produces a gray coat. These two alleles pairs assort independently. If a gray rabbit that is heterozygous at the gene locus controlling ear length is mated with a white rabbit that is also heterozygous at the gene locus controlling ear length, what is proportion of the long-eared offspring will be homozygous for the long-eared trait?

Answer 1

1/3

Question 2

Two parents each have blood type AB, and their first child has blood type AB. What is the probability that their second child will have blood type AB?

Answer 2

50%

Question 3

Consider the cross AaBbCcddEe x AABBccDDEe. If these 5 allele pairs assort independently, then the probability that any individual offspring will have the genotype AABBccDdEe is 1 out of___.

Answer 3

16

Question 4

Different phenotypes produced for the same genotype due to environmental variation is called ___

Answer 4

Phenotypic Plasticity

Question 5

A genetic __ indicated the distances between gene loci measured in terms of frequency of recombination.

Answer 5

map

Question 6

Traits that are controlled by genes located on the X chromosome are said to be___.

Answer 6

sex-linked

Question 7

What is the relationship between recombination frequency and the actual physical distance on a chromosome?

Answer 7

As physical distance increases, the recombination frequency first increases in a linear fashion, but eventually reaches a maximum of 0.5 or 50%

Question 8

Pedigrees are useful to genderists because they can help determine

Answer 8

a. The mode of inheritance for a particular trait

b. The genotype of a particular individual

c. The probability that future offspring will inherit a particular trait

d. Whether a particular trait is dominant or recessive

Question 9

Messenger RNA molecules contain information that is used to synthesize

Answer 9

Polypeptides

Question 10

To begin transcription, RNA polymerase must bond to a segment of DNA called the ___.

Answer 10

Promoter

Question 11

The strand of DNA that is not transcribed is called the ___ strand.

Answer 11

Coding

Question 12

A codon is composed of how many bases?

Answer 12

3

Question 13

In eukaryotic cells, transcription occurs

Answer 13

Inside the nucleus

Question 14

If the sequence of bases in the template strand of a DNA molecules is 3’ ATCGCTCC 5’, what is the sequence of bases in the RNA that is transcribed from this molecule?

Answer 14

5’ UAGCGAGG 3’

Question 15

What is the fist step during transcription initiation in prokaryotes?

Answer 15

RNA polymerase binds to the promoter

Question 16

You are helping to decode some genome seqnece. Unfortunately the sequencing compony forgot to tell you which is the 5’ and 3’ ends of the double-stranded DNA sequence below. However, know that the sequence codes for Met-Leu-Trp…

Strand #1 ACAATGAGGCCAGAGCATAAT; Strand #2 TGTTACTCCGGTCTCGTATTA

Answer 16

2, right to left

Question 17

In humans, RNA polymerase begins transcription at a ___ and stops at a___

Answer 17

Promoter, termination sequence

Question 18

Genes that are very far apart on a long autosome are:

Answer 18

So likely to have crossing over that they appear to assort independently

Question 19

Which of the following correct about reading genes on a chromosome ( a double stranded DNA molecule)?

Answer 19

One strand is read as template for each gene, with the strand serving as template differing for various genes

Question 20

The START codon is:

Answer 20

The first AUG after the +1 transcription initiation site

Question 21

In leopards, dark spots (D) are dominant to light spots (d). A separate epistatic gene controls the presence of spots. Lack of spots (n) is recessive to the presence of spots (N). P1 has offspring with a mate that has dark spots (P2). The offspring include animals with dark spots, light spots, and no spots, what are the genotypes of the parents?

Answer 21

P1: Nndd P2: NnDd

Question 22

Cystic fibrosis in humans is caused by mutations in a single gene and is inherited as an autosomal (non-sex chromosome) recessive trait. A normal couple has two children. The first child has cystic fibrosis, and the second child is unaffected. Given that you know the second child’s phenotype, what is the probability that the second child is a carrier (heterozygous) for the mutation that causes the disease?

Answer 22

2/3

Question 23

In the germline cell below, there are two pairs of chromosomes on which are shown the locations of tw different genes. F and f represent two different alleles (versions or variants) of one gene, and Q and q represent two different alleles of another egen. If this cell divides normally to produce sperm, what are the possible sperm genotypes.

Answer 23

FQ, fq, Fq, fQ

Question 24

Deviations from expected rations (9:3:3:1, for example) found in Mendelian genetics caused by epistasis or complementation are proof that ___?

Answer 24

The gene products of different genes can both affect a phenotype

Question 25

You are working the ER wing at Grady memorial hospital when a family comes in with their child. The parents of the child explain that the child scraped his knee and that the injury was still bleeding hours afterwards. You identify this to likely be the result of hemophilia, a blood clotting disorder. However, neither the father nor mother has ever experienced this themselves. Assuming the child is their biological child of the parents, how ca you explain this phenomenon?

Answer 25

Hemophilia is a sex-linked recessive disorder - the mother must be a carrier for it

Question 26

Cactophilic fruit flies Peluso and colleagues (2016; doi:10.3390/insects7020021) carried out a study in which they compared the number of ovarioles (egg-producing organs) in the two fruit fly species Drosophila buzzatii and D. koepferae when feeding on two different cactus species (Opuntia sulphurea and Trichocereus terscheckii). In the graphs below, each pair of points connected by a line is a fruit fly genotype (note: data points and bars show means and standard errors). Use this figure for the following two questions. Which of the two fruit fly species shows the greatest genotypic variation in ovariole number?

Answer 26

D. buzzatii

Question 27

In a two-point test cross, 36 of the offspring were recombinant types. The remaining 64 offspring were parental types. How many map units separate the two loci?

Answer 27

36

Question 28

In fish, two linked genes (A and B) are 30 map units apart. A-purple, ared, B=long tail, b=short tail. A pure-breeding purple, long-tailed animal is crossed to a red, short-tailed animal. One of the F1 offspring is then crossed to a red, short-tailed individual. They have 500 offspring. How many offspring from this mating would be predicted to be purple, short-tailed individuals?

Answer 28

75 (15%)

Question 29

What is the probability of person C being a carrier?

Answer 29

100%

Question 30

What is the probability that person A being a carrier?

Answer 30

100%

Question 31

What is the probability that person E has the disease?

Answer 31

1/8

Question 32

What is the probability that person D being a carrier?

Answer 32

50%

Question 33

Many caves in Mexico harbor fish that have lost their eyes over evolutionary time. At these same locations, fish living in surface waters have functional eyes. As a researcher, you collected cave fish and surface fish from three locations (1, 2 and 3). You find that crosses between blind fish from the same location never result in offspring with functional eyes, but that 100% of the offspring of crosses between cave fish and surface fish from the same location have functional eyes. Next, you decide to cross blind cave fish from the three different locations, as shown in the table. Based on these results you conclude that:

Answer 33

The development of functional eyes is based on at least two loci; at least one dominant allele is required at each locus to result in functional eyes.

Question 34

Recall the case of the Blind cave fish from class. The phylogenetic tree below suggests that, in addition to complementation, this case also illustrates an example of

Answer 34

Convergent evolution

Question 35

For the SNP most associated with coat color, what is the most accurate description of it?

Answer 35

To be located in the gene controlling coat color

Question 36

From the SNP information below, which locus (1-7) is most associated with coat color in dogs?

Answer 36

7

Question 37

Judging from the GWAS figure, If you were a researcher studying Crohn's disease and you only had funding sufficient to target one chromosome for study (Goal: Identify genes responsible for the disease ), which chromosome should you study?

Answer 37

Chromosome 5

Question 38

Many genes are pleiotropic, meaning they affect more than one phenotype. Which two chromosomes from the GWAS figure appear to contain genes that affect both Rheumatoid arthritis and Type 1 diabetes.

Answer 38

Chromosome 6 and 1