Exam 1 Review

Question 1

1. a) What is the base sequence of the DNA strand that would be complimentary to the following single-stranded DNA molecule? 5’-ATGTCGCGGGTTGACAATTTAACTGTCGCGCCGGGTTCACCGGATG -3’

Answer 1

3’- TACAGCGCCCAACTGTTAAATTGACAGCGCGGCCCAAGTGGCCTAC -5’

Question 2

1. b) Based on the sequence in the previous question, what would be the DNA base sequence and what amino acids would result? (use the amino acid chart)

Answer 2

Remember we are now using mRNA, making the sequence:

5’- AUG UCG CGG GUU GAC AAU UUA ACU GUC GCG CCG GGU UCA CCG GAU -3’

The amino acids would go as follows:

Met - Ser - Arg - Val - Asp - Asn - Leu - Thr - Val - Ala - Pro - Gly - Ser - Pro - Asp

The open reading frame is determined by the start codon (AUG in this case)

Question 3

If the Sense Strand codon is 5’-[TAC]-3’ What is the:

• Anti-sense codon
• mRNA codon
• tRNA codon
• Amino Acid

Answer 3

(Given) Sense: 5’-TAC-3’

Anti: 3’-ATG-5’

mRNA: UAC

tRNA: AUG

Amino Acid: Tyr

Question 4

If the mRNA codon is [CAA] What is the:

Sense codon

Anti-sense codon

tRNA codon

Amino Acid

Answer 4

This problem requires you to work forwards and backwards. Starting with mRNA, you can translate the Anti-sense to GTT, and the tRNA to GUU. From there you can translate the Sense from the anti-sense as CAA and the amino acid from the tRNA as Gln.

Overall:

Sense: CAA

Anti: GTT

(Given) mRNA: CAA

tRNA: GUU

Amino: Gln

Question 5

T or F: A Mutation ALWAYS causes a mutant Phenotype

Answer 5

False

Question 6

A messanger acid is 336 nucleotides long, including the initiator and terminator sequence. the number of amino acids in the proteins translated from this mRNA is:

a) 999
b) 630
c) 330
d) 111
e) 110

Answer 6

336/3=112

3 nucleotides per amino acid

112-1=111

(-1 because stop codon does not translate into amino acid)

Answer d) 111

Question 7

A _____ mutation affects the phenotype only under certain conditions.

a) spontaneous
b) somatic
c) site-directed
d) conditional

Answer 7

d) conditional

Question 8

Changing the codon ACC to AGA represents a ______ mutation.

a) missense
b) nonsense
c) frameshift
d) deletion

Answer 8

ACC = Thr

AGA =Ars

a) missense

Question 9

A point mutation that changes a codon specifying an amino acid into a stop codon is called a:

a) missense mutation
b) nonsense mutation
c) frameshift mutation
d) deletion mutation

Answer 9

b) Nonsense Mutation

Question 10

The enzyme that creates a short RNA oligonucleotide at initiation sites where replication is to be carried out os called:

a) Primase
b) DNA Ligase
c) DNA Gyrase
d) Exonuclease

Answer 10

a) Primase

Question 11

T or F: Gram-negative bacteria have double cell membranes.

Answer 11

True

Question 12

T or F: Nucleotides in each strand are linked by 5’-3’ phosphodiester bonds.

Answer 12

True

Question 13

T or F: DNA synthesis on the lagging strand is continuous.

Answer 13

False (due to Okazaki Fragments)

Question 14

T or F: Bacteria have one circular chromosome that is the main genome which carries housekeeping genes.

Answer 14

True

Question 15

T or F: The lagging during DNA synthesis the Okasaki Fragments are being synthesized

Answer 15

True

Question 16

T or F: The replication of the bacterial chromosome is unidirectional.

Answer 16

False

Question 17

_______ relaxes the DNA strand

Answer 17

Topoisomerase

Question 18

______ opens the strand and acts as a guide for primase on both strands.

Answer 18

Helicase

Question 19

_______ keeps the DNA strand apart during replication process.

Answer 19

SSBP (Single Stranded BInding Protein)

Question 20

_______ synthesize primer sequences that are used by DNA polymerase III.

Answer 20

Primase

Question 21

_______ extends strands only in 5’-3’ direction, thus one strand is continuous and one is in short fragments (Okazaki Fragments)

Answer 21

DNA Polymerase

Question 22

Replication continues until the replication fork enters a region of the chromosome called the ________.

Answer 22

Termination Region

Question 23

T or F: Partitioning of the chromosome is the distribution of one daughter chromosome to each of the two daughter cells.

Answer 23

True

Question 24

________ is able to pick up a specific amino acid and transfer it to ribosomes.

Answer 24

tRNA

Question 25

\_\_\_\_\_\_\_ is synthesized complementary to a gene and subsequently translates into a polypeptide or protein at ribosomes

Answer 25

mRNA

Question 26

T or F: The promoter is a neuleotide sequence located up-stream of the gene to which RNA polymerase binds at the initiation of transcription

Answer 26

True

Question 27

\_\_\_\_\_ is where an aminoacyl-tRNA first attaches.

Answer 27

Site A/acceptor/aminoacyl site

Question 28

\_\_\_\_\_\_ is where the growing amino acid chain is temporarily being held by a tRNA as the next xodon in the mRNA is being read.

Answer 28

Site P/Peptide site

Question 29

The peptide bond is formed by a ribozyme, called \_\_\_\_\_\_.

Answer 29

Peptidyl transferase

Question 30

The 70s ribosome moves a distance of one codon down the mRNA through a process called \_\_\_\_\_\_.

Answer 30

Translocation

Question 31

What breaks the covalent bond that holds the finished protein to the terminal tRNA

Answer 31

Site P/Peptide site

Question 32

T or F: Sec YEG are proteins that assist the non-covalent folding/unfolding

Answer 32

True

Question 33

A nucleic acid was analyzed and found to contain 32% A, 18% G, 17% C, and 33% U. The nucleic acid must be: a) single stranded RNA b) single stranded DNA c) double stranded RNA d) double stranded DNA

Answer 33

a) single stranded RNA

Question 34

T or F: the Ter region is the area that contains multiple symmetrically arranged sites for trapping the replication fork.

Answer 34

True

Question 35

Which mRNA codes for the following polypeptide? Met - Arg - Ser - Leu - Glu a) 3'-AUGCGUAGCUUGGAGUGA-5' b) 3'-AGUGAGGUUCGAUGCGUA-5' c) 5'-AUGCGUAGCUUGGAGUGG-3' d) 1'-AUGCGUAGCUUGGAGUGA-3' e) 3'- AUGCGUAGCUUGGAGUGA-1'

Answer 35

c) 5'-AUGCGUAGCUUGGAGUGG-3'