Exam 2 Flashcards

Question

holoenzyme

Answer 1

The complete transcription initiation complex Consists of RNA polymerase core + sigma factor Sigma factor confers promoter specificity Holoenzyme binds promoter and initiates transcription After initiation, sigma released and core does elongation

Answer 2

Promoter Recognition: Sigma factor of RNA polymerase holoenzyme recognizes and binds to promoter DNA sequence Promoters have -10 and -35 regions that sigma factor binds to Closed Complex Formation: RNA polymerase holoenzyme binds to promoter, forming a stable closed complex Open Complex Formation: DNA strands are unwound/melted open around the transcription start site (+1) Helped by sigma factor and transcription factors binding upstream Initiation: RNA polymerase begins synthesizing RNA transcript complementary to the coding strand Incorporates first few ribonucleotides using DNA template strand Forms an initiation complex or open complex After initiation: Sigma factor is released from the core RNA polymerase enzyme Core enzyme proceeds into the elongation phase Key players: Promoter DNA sequence Sigma factor for recognition RNA polymerase holoenzyme Transcription factors The initiation phase sets up the transcription bubble and allows transition into elongation.

Answer 3

Here are the key points about the transcription elongation phase in bacteria: Elongation Complex: - After initiation, sigma factor dissociates - Core RNA polymerase enters elongation phase as the elongation complex RNA Synthesis: - RNA polymerase moves along DNA template strand - Adds ribonucleotides one by one to the 3' end of growing RNA transcript - Synthesizes in the 5' to 3' direction - Unwinds DNA helix to expose template strand Transcription Bubble: - Region of unwound DNA around active site - Maintains ~12-14 bp of DNA unwound Proofreading: - RNA polymerase has intrinsic 3'->5' exonuclease activity - Removes misincorporated ribonucleotides for high fidelity Regulation: - Elongation factors can modulate RNA polymerase's activity - Transcription-coupled repair mechanisms act during elongation Termination Signals: - Specific DNA sequences/structures signal termination - Rho protein aids termination at some terminators The elongation complex faithfully copies the DNA template into an RNA transcript until it reaches a termination signal.

Answer 4

Here are the key points about transcription termination in bacteria: Intrinsic Termination: - Occurs at specific DNA sequences that form a hairpin loop followed by a U-rich region - Hairpin causes RNA polymerase to pause and dissociate from the DNA template - Common in prokaryotes and some eukaryotes Rho-dependent Termination: - Involves the rho protein binding to the C-rich rho utilization (rut) site on the nascent RNA - Rho translocates along the RNA, removing RNA polymerase from the DNA - Common in prokaryotes Steps: 1) Termination signal sequence is transcribed 2) RNA polymerase pauses/stalls 3) Conformational change destabilizes the transcription complex 4) Completed mRNA transcript is released 5) RNA polymerase dissociates from the DNA template Terminators ensure efficient termination and recycling of RNA polymerase after genes are transcribed. Termination prevents: - Interference with downstream genes - Depletion of RNA polymerase and ribonucleotide pools Proper termination is critical for gene regulation and transcriptional control.

Answer 5

DNA sequence that signals the end of transcription Contains a hairpin loop followed by a U-rich region Hairpin causes RNA polymerase to pause/stall

Answer 6

Stem-loop structure formed by the nascent mRNA at the terminator G-C base pairs in the stem, loop at the end Hairpin causes physical disruption of transcription complex Facilitates release of the mRNA transcript

Answer 7

is the process by which a gene gets turned on/off in a cell to make RNA and proteins. Gene expression may be measured by looking at the mRNA transcribed (mRNA expression), or the protein translated from the mRNA (protein expression)

Answer 8

sigma factor

Answer 9

* 1 circular chromosome (& circular plasmids) * Not-membrane bound in nucleus (nucleoid region) * Double-stranded DNA * Circular chromosome compacted nearly 1000x to fit in the nucleoid region * Bacterial histone-like proteins (bend instead of wrap DNA)

Answer 10

* Smaller in size (#base pairs) than euk * High proportion of protein-coding sequence (only ~10% non-coding) * Coding sequences are continuous (contiguous) *no introns * Both DNA strands can contain the coding sequence

Answer 11

are clusters of genes transcribed as one unit. They have one promoter and one mRNA is produced. Each gene’s coding sequence is translated from the single mRNA. thrA, thrB, and thrC proteins will be made from the single mRNA. These proteins often function together in the cell. Operons are common in bacteria and much less common in eukaryotes.

Answer 12

The lac operon genes will produce enzymes that break down lactose when lactose is present. Inducible operon is off until the inducer molecule ”induces” the operon by inhibiting the repressor (through binding it) *Inhibit an inhibitor = ON

Answer 13

Tryptophan operon contains genes that work together to synthesize the amino acid tryptophan when it is absent Repressible operons are on until the co-repressor binds the repressor.

Answer 14

molecule that binds a protein (e.g. Iron is the ligand for Fur repressor)

Answer 15

* Gene expression is the process by which the instructions in a gene are used to synthesize functional gene products (proteins or non-coding RNAs) * It involves two main steps: - Transcription: DNA is transcribed into RNA - Translation: RNA is translated into proteins * Gene expression is highly regulated for several reasons: - Different cells express different genes for specialized functions - Genes are expressed at the right time and level based on the cell's needs - Regulating expression prevents wasteful overproduction of proteins - It allows the cell to respond to environmental signals and changes * Regulation occurs at multiple levels: - Transcriptional regulation (activating/inhibiting transcription) - RNA processing and stability - Translational regulation - Post-translational modifications of proteins * Precise gene regulation is crucial for normal development, cellular differentiation, and maintaining proper cellular function

Answer 16

Bacterial Genomes: - Single circular chromosome (some bacteria have additional small circular plasmids) - Relatively small genome size (few million base pairs) - Lack membrane-bound nucleus - DNA is naked, not associated with histones - Genes are densely packed with little non-coding DNA - Operons allow coordinated regulation of related genes - Absence of introns (genes are continuous) - Rapid replication and cell division Contrasting with Eukaryotic Genomes: - Multiple linear chromosomes - Much larger genome sizes (billions of base pairs) - DNA packaged into nuclei with histones - Significant amount of non-coding DNA (introns, regulatory regions) - Genes are discontinuous (exons separated by introns) - Complex transcriptional regulation at individual gene level - Presence of membrane-bound organelles like nucleus, mitochondria - Slower replication and cell cycle Overall, bacterial genomes are simpler, more compact, and lack the complexity of eukaryotic regulation and nuclear organization.

Answer 17

Operons: - Operons are clusters of genes that are co-transcribed from a single promoter - Allow coordinated regulation of related genes involved in the same pathway - Characteristic of bacterial genomes and some archaea Inducible Operons: - Genes are normally turned off (not transcribed) - Presence of an inducer molecule activates transcription - Inducer binds to a repressor protein, inactivating it - Allows RNA polymerase to bind and transcribe the operon Example: lac operon in E. coli - Induced by lactose to produce enzymes for lactose metabolism - Lack of glucose also induces (glucose prevents induction) Repressible Operons: - Genes are constitutively transcribed by default - Presence of a corepressor molecule represses/turns off transcription - Corepressor binds to a repressor protein, activating its binding to operator Example: trp operon in E. coli - Repressed when tryptophan levels are high (corepressor present) - Allows regulation of tryptophan biosynthesis This coordinate regulation allows bacteria to efficiently express genes when needed and conserve resources otherwise.

Answer 18

Inducible Operons: - Regulated by repressor protein that binds to operator, blocking transcription - Inducer molecule binds to and inactivates repressor - This allows RNA polymerase to bind promoter and transcribe operon Repressible Operons: - Regulated by repressor protein + corepressor molecule - Corepressor binds repressor, increasing its affinity for operator - Activates repressor binding, blocking RNA polymerase Regulatory Elements: - Promoter - RNA polymerase binding site to initiate transcription - Operator - Repressor protein binding site that blocks transcription - Inducer/Corepressor - Small molecules that modulate repressor activity Transcription Factors: - Repressors - Bind operator to repress transcription (e.g. LacI, TrpR) - Activators - Bind DNA and recruit RNA polymerase (e.g. CRP for lac) - Coactivators - Help activators bind/function (e.g. CAP for lac) - Inducers - Inactivate repressors, allowing transcription - Corepressors - Activate repressors to block transcription This interplay between activators, repressors, inducers, and corepressors allows bacteria to precisely control operon expression in response to environmental/metabolic conditions.

Answer 19

Scenario 1: Certain genes are normally not expressed. However, when a specific small molecule is added to the bacterial culture, those genes become expressed. This describes an inducible operon. The small molecule acts as an inducer, inactivating the repressor protein and allowing transcription of the operon. Scenario 2: A set of enzymes involved in an amino acid biosynthesis pathway are produced continuously. But when the amino acid is added to the growth medium, production of those enzymes stops. This is an example of a repressible operon. The amino acid acts as a corepressor, binding to and activating the repressor protein to block transcription of the operon. Scenario 3: Genes encoding enzymes for lactose metabolism are expressed only when lactose is present and glucose is absent in the growth medium. This matches the regulation of the famous lac operon, which is an inducible operon. Lactose acts as the inducer, while glucose prevents induction (glucose repression). Scenario 4: A repressor protein is bound to the operator region, blocking transcription. Adding a specific metabolite causes the repressor to change shape and fall off the operator. This scenario depicts an inducible operon where the metabolite is the inducer that inactivates the repressor protein bound at the operator. The key is to identify if a small molecule is allowing transcription (inducer) or blocking it (corepressor) to distinguish inducible vs. repressible regulation.

Answer 20

Here are some tips for reading a transcriptional profile or gene expression data represented by colored blocks to determine which genes are turned on or off: 1. Look at the scale/legend to understand what the colors represent: - Red typically indicates high expression/upregulation - Green usually means low expression/downregulation - Black or gray often represents baseline/no change 2. Compare across conditions/time points: - Bright red blocks indicate that gene is highly expressed in that condition - Bright green blocks mean the gene is repressed/low expression 3. Look for patterns within rows (same gene): - A row with mostly red means that gene is generally highly expressed - A row with mostly green suggests that gene has low expression levels 4. Focus on differences between conditions within a row: - A switch from red to green indicates the gene was downregulated - Change from green to red means the gene became upregulated 5. Subtle shades indicate degrees of change: - Darker reds = very high expression - Lighter greens = modest downregulation 6. Black/gray blocks typically mean no significant change in expression. The key is correlating the color intensity to expression levels based on the scale and looking for contrasting patterns between conditions/time points to identify up/downregulated genes. With practice, these visual profiles provide a powerful way to analyze gene expression data.

Answer 21

- Transcriptional regulation is a complex process involving the interplay of multiple components: - Regulatory DNA sequences (promoters, enhancers, silencers, insulators) - Transcription factors (activators, repressors, co-regulators) - Chromatin remodeling complexes - DNA methylation/epigenetic modifications - Promoters alone can have multiple binding sites for: - Activators that recruit RNA polymerase - Repressors that block polymerase binding - General transcription factors required for initiation - Enhancers are distal regulatory regions that can bind: - Activators to increase transcription - Repressors to decrease transcription - Interactions with promoters via DNA looping - Transcription factors can act cooperatively: - Multiple activators synergize for stronger activation - Activators and repressors compete for binding - Co-activators/co-repressors modulate activity - Chromatin structure and epigenetics add another layer: - Open chromatin allows transcription factor access - Closed/methylated chromatin blocks binding - Chromatin remodelers alter accessibility - Cell type and environmental signals dictate which factors are present - The precise combination of sequences, binding factors, chromatin state determines the transcriptional output This modularity and cooperativity of regulatory components allows incredibly precise spatiotemporal control of gene expression programs.

Answer 22

* Bacteria lack histones but have histone-like proteins called nucleoid-associated proteins (NAPs) * NAPs help compact and organize bacterial DNA into a nucleoid structure * The nucleoid functions like a simpler form of eukaryotic chromatin * Examples of bacterial NAPs: HU, H-NS, IHF, Fis, Dps * NAPs bind DNA, induce bends/loops, and condense the DNA molecule * The bacterial nucleoid, organized by NAPs, is analogous to eukaryotic chromatin organized by histones

Answer 23

The nucleoid region is a condensed area within a prokaryotic cell where the genetic material, typically in the form of a circular chromosome, is located. It lacks a membrane-bound nucleus found in eukaryotic cells.

Answer 24

An operon is a functional unit of genetic material found in prokaryotic cells consisting of a cluster of genes under the control of a single promoter. It includes structural genes that encode proteins, along with regulatory elements such as an operator and a promoter. The operon allows for coordinated gene expression, typically in response to environmental signals.

Answer 25

An inducible operon is a genetic regulatory system in prokaryotic cells where gene expression is normally off but can be turned on in response to specific environmental signals or molecules.

Answer 26

An inducer molecule is a substance that initiates or enhances the expression of specific genes in an organism by interacting with regulatory proteins such as transcription factors.

Answer 27

A repressible operon is a genetic regulatory system in bacteria where the transcription of a group of genes is typically active, but can be inhibited (repressed) when a specific molecule, usually a product of the metabolic pathway controlled by those genes, is present in abundance.

Answer 28

A co-repressor is a molecule that binds to a repressor protein, enhancing its ability to inhibit the expression of specific genes. This binding typically occurs in regulatory systems where the presence of the co-repressor is associated with certain environmental or cellular conditions.

Answer 29

An operator is a DNA sequence found within the promoter region of a gene that serves as a binding site for regulatory proteins, such as repressors or activators. The binding of these proteins to the operator can either inhibit or facilitate the initiation of transcription of the adjacent gene(s).

Answer 30

The untranslated region (UTR) is a segment of mRNA (messenger RNA) that lies outside the coding sequence of a gene. It occurs both upstream (5' UTR) and downstream (3' UTR) of the coding region. While not translated into protein, UTRs play important roles in regulating gene expression, mRNA stability, and localization within the cell.

Answer 31

A co-activator is a protein that interacts with transcription factors to enhance the transcriptional activity of specific genes. Co-activators typically do not directly bind to DNA but instead facilitate the assembly of transcriptional machinery or modify chromatin structure to promote gene expression. They play crucial roles in regulating various cellular processes by modulating gene transcription.

Answer 32

Similarities: * Both involve proteins that bind and compact DNA * Serve to organize and package the genetic material * Help condense long DNA molecules into more compact structures Differences: * Eukaryotes use histone proteins, bacteria use histone-like NAPs * Eukaryotic chromatin is more complex, with multiple levels of organization * Bacterial nucleoid is a simpler, more loosely packaged structure * Histones form nucleosomes, the basic unit of eukaryotic chromatin * NAPs don't form nucleosome-like structures in bacteria * Chromatin undergoes more dynamic changes (condensation/decondensation) during cell cycle * Bacterial nucleoid is more static, less regulated compaction In essence: * Both use proteins to compact and organize DNA * But eukaryotic chromatin is a more complex, dynamic, and regulated process * Bacterial nucleoid formation by NAPs is a simpler, more static process

Answer 33

Here are some concise points to help deduce the type of operon (inducible or repressible) from scenarios or diagrams: Inducible Operon: - Genes are normally OFF or expressed at low levels - Presence of an inducer molecule/signal turns ON expression - Often used for catabolic operons (breaking down substrates) - Example: lac operon induced by lactose, allows bacteria to metabolize lactose Repressible Operon: - Genes are normally ON or constitutively expressed - Presence of a corepressor molecule/signal turns OFF expression - Often used for anabolic operons (biosynthesis pathways) - Example: trp operon repressed by tryptophan, stops production when enough tryptophan Deducing from Scenarios/Diagrams: - If operon is OFF normally, needs a molecule/signal to turn ON → Inducible - If operon is ON normally, needs a molecule/signal to turn OFF → Repressible - Look for inducers (substrates, metabolites) that activate expression → Inducible - Look for corepressors (end-products) that repress expression → Repressible - Iron-stealing operon likely inducible, turned ON by iron starvation signal So analyze the normal/default state, regulatory molecules involved, and whether they activate or repress expression to deduce inducible vs repressible.

Answer 34

- High signal/intensity = gene is expressed (turned on) - Low/no signal = gene is not expressed (turned off) - Compare conditions to see induction (turned on) or repression (turned off) - Clustered patterns indicate co-regulated genes - Sharp increases/decreases = genes turned on/off in response - Consistent expression = constitutive (always on) - Changes over time = dynamic regulation - Correlate with known regulators/pathways for insights

Answer 35

* Inducible operons are OFF (not transcribed) because repressor IS bound to the operator in the absence of inducer molecule. Should make sense, operon off without the inducer. * When inducer molecule present it binds to repressor and causes repressor to dissociate from operator which induces the operon (transcribed) * Repressible operons are ON (transcribed) because repressor is NOT bound to the operator in the absence of co-repressor molecule. Should make sense, operon on without the co-repressor. * When co-repressor molecule present it binds to repressor and causes repressor to bind the operator which represses the operon (not transcribed)

Answer 36

b) somewhere soon after AAUAAA

Answer 37

* Membrane-bound (nucleus) chromosomes * Linear chromosomes * Compacted and wrapped around proteins called histones (8 histones make up a nucleosome) * MOST compacted during mitosis/meiosis * Lots of non-coding sequence (intergenic – between genes) * AND non-coding sequence within genes (introns) * Eukaryotic genes are NOT continguous; coding sequence (exons) is broken up with introns * Genes go in both ‘directions’ – meaning the coding strand can be on the top or bottom DNA strand of the double helix (same in bacteria) * Lots of repetitive sequences! (don’t worry about what theses are)

Answer 38

Eukaryotic mRNA made is in a pre-mRNA state – not actual message used to make protein yet. Pre-mRNA modified w/ Cap, polyA Tail, and spliced in the nucleus to become mature mRNA! Bacteria modify the 5’ end of mRNAs too – but let’s just say it’s more extensive in eukaryotes. 5’ cap - Modified guanine nucleotide added to 5’ of mRNA (technically happens during txn). Function: bind ribosomes & protect mRNA from degradation

Answer 39

50-300 A’s; added after termination. Function: protects from degradation; Aids in nuclear export of transcript

Answer 40

Notice there is an Un-Translated Region (UTR) both on the 5’ and 3’ end of the mRNA Bacteria have UTRs as well. Served regulatory functions as well. Splicing technically happens co-/post-transcriptionally. Do not worry about the specific order of processing like 5’ cap, polyA, splicing. We will lump them as post-transcription.

Answer 41

MANY ways to splice mRNA Each of these would be translated into a different protein! from one MRNA multiple variations of the coding seq that give unique proteins.

Answer 42

Different TFs (proteins) may also have different affinity for the same regulatory sequence. Affinity is the strength/weakness at which an interaction occurs. There may also be different amounts of the proteins available in the cell! regulating seg. differences can affect TF affinity.

Answer 43

Regulatory small non-coding RNAs (ncRNA) can regulate gene expression. *usually bind in the 5’ or 3’ UTRs of mRNA transcripts; 20-25 nt long short interfering RNA (siRNA) = perfect match – degrade mRNA (post-transcription reg) micro RNA (miRNA) = imperfect match – block translation (post-transcription reg) Bacteria do not have the proteins for siRNA but have ways to regulate their mRNAs post- transcriptionally using the UTRs as well

Answer 44

a) A-T, T-A, G-C, & C-G base pairs present different shapes and chemical groups in the grooves of DNA Regulatory sequences are bound in a double-stranded manner via a “hydrogen bonding” code in the major and minor grooves

Answer 45

Bigger the letter the more often it is found in the TATA box of the particular type of genes.

Answer 46

Initiation: RNA polymerase II binds to promoter region of gene Transcription factors assist binding and initiation General transcription factors recruit RNA pol II to promoter TFIIH unwinds DNA to allow transcription bubble formation Elongation: RNA pol II moves along template strand, synthesizing RNA Transcription elongation factors assist and regulate process RNA pol II unwinds DNA ahead, re-anneals behind as it moves 5' cap added to nascent mRNA RNA splicing occurs - introns removed, exons joined Termination: Termination signals in DNA sequence trigger process RNA pol II dissociates from DNA template Polyadenylation factors add poly-A tail to 3' end of mRNA Fully processed, mature mRNA is released for translation

Answer 47

Recruiting RNA Polymerase II (RNAP II) to the promoter is key for initiation TATA-binding protein (TBP) binds to TATA box in promoter TBP assists binding of other general transcription factors (GTFs) Together they form pre-initiation complex (pre-IC) Difference from bacteria: In bacteria, RNAP alone can bind promoter and initiate In eukaryotes, RNAP II requires pre-IC with TBP and GTFs first RNAP II joining pre-IC: Pre-IC recruits RNAP II to promoter RNAP II joins, forming full initiation complex (IC) Initiation completion: Within IC, RNAP II unwinds DNA around transcription start site This formation of transcription bubble completes initiation stage

Answer 48

DNA Looping in Eukaryotes: - Distal enhancers can be thousands of base pairs away from promoter - DNA loops bring enhancers into close proximity with promoter - This enhancer-promoter looping is mediated by transcription factors - Allows regulatory proteins bound at enhancers to interact with transcription machinery DNA Looping in Bacteria: - Distal cis-regulatory sequences located upstream or downstream of promoter - DNA is looped to allow binding of transcription factors near promoter - Loop formation assisted by nucleoid-associated proteins - Allows transcription factors bound at distant sites to influence initiation complex General Points: - DNA looping overcomes linear distance between regulatory elements and promoters - Enables communication between distal binding sites and transcription machinery - Allows integration of multiple regulatory signals for controlled initiation

Answer 49

- The elongation process itself is similar in eukaryotes and bacteria - RNA polymerase moves along DNA template, synthesizing mRNA - Transcription elongation factors assist and regulate the process - Key difference is the coupling to translation: - In bacteria, translation can begin as mRNA is being transcribed (coupled) - In eukaryotes, transcription occurs in nucleus but translation in cytoplasm - So eukaryotic mRNA cannot be translated as it is being transcribed - This separation is due to: - Nuclear envelope barrier in eukaryotic cells - mRNA must be fully transcribed, processed, exported to cytoplasm - Only then can translation on mature mRNA occur in the cytoplasm - In bacteria (no nuclear envelope): - Ribosomes can directly access and translate the nascent mRNA - Allowing co-transcriptional translation to occur efficiently

Answer 50

Eukaryotes: - Termination guided by terminator sequence in DNA - This causes RNAP to dissociate, releasing the nascent mRNA - Just upstream of terminator is a poly(A) signal sequence - This poly(A) signal is not used during transcription termination itself - After termination, the poly(A) signal sequences guide: - Endonucleolytic cleavage of the 3' end of the mRNA - Addition of a poly(A) tail to the 3' end by poly(A) polymerase Bacteria: - Termination can occur through rho-independent or rho-dependent mechanisms - Rho-independent uses RNA hairpin followed by U-rich sequence - No poly(A) tail is added to bacterial mRNAs - The 3' end is simply the last transcribed portion Key Differences: - Eukaryotes use separate terminator and poly(A) signals - Poly(A) tail added as a post-transcriptional processing step - Bacteria lack poly(A) tails and processing of the 3' end - Termination signals are encoded differently

Answer 51

Coding Sequences: - Regions of DNA that get transcribed into mRNA - The mRNA is then translated into proteins - Include exons of genes that code for proteins - Make up a small fraction of the genome (~1-2% in humans) Non-Coding Sequences: - Regions of DNA that do not code for proteins - Not transcribed into mRNA that gets translated - Include introns within genes - Also regulatory regions like promoters, enhancers, silencers - Repeat sequences, telomeres, centromeres etc. - Comprise the vast majority of the genome (~98% in humans) Key Points: - Coding sequences are the protein-coding exons - Non-coding includes introns, regulatory regions, other genomic sequences - Non-coding sequences can still be transcribed into non-coding RNAs - But they don't get translated into proteins - The non-coding portion is much larger than the coding portion So in summary - coding = exons that get translated into proteins - non-coding = introns, regulatory, other non-translated sequences

Answer 52

Here are the key points about contiguous versus non-contiguous genes: Contiguous Genes: - Genes that are located right next to each other on the same chromosome - The coding sequences are contiguous/uninterrupted - No non-coding regions or other genes in between Non-Contiguous Genes: - Genes that are separated by stretches of non-coding DNA - The coding sequences are non-contiguous/interrupted - Interspersed with introns, regulatory regions, other genes etc. In both cases: - The coding sequences (exons) are transcribed into mRNA - Introns and other non-coding regions are removed during splicing Key Differences: - Contiguous genes don't require splicing of the transcript - Non-contiguous genes require splicing to remove interrupting sequences - Contiguous genes are relatively rare in eukaryotes - Most eukaryotic genes are non-contiguous due to presence of introns So in summary: - Contiguous = Coding sequences are together without interruptions - Non-contiguous = Coding sequences are separated by non-coding regions - Most eukaryotic genes are non-contiguous and require splicing

Answer 53

A polyadenylation signal, often abbreviated as polyA signal, is a specific nucleotide sequence in mRNA precursor molecules (pre-mRNA) that signals the addition of a polyadenylate (poly-A) tail during mRNA processing. This signal is recognized by proteins involved in mRNA maturation, leading to the cleavage of the pre-mRNA and the addition of a string of adenine nucleotides (poly-A tail) to the mRNA's 3' end. The poly-A tail plays roles in mRNA stability, transport, and translation.

Answer 54

RNA Polymerase II (RNA Pol II): - Transcribes protein-coding genes - Produces precursors of mRNA that will be translated into proteins - Includes promoter recognition, initiation, elongation, termination - Transcripts are capped, spliced, polyadenylated RNA Polymerase I (RNA Pol I): - Transcribes ribosomal RNA (rRNA) genes - rRNA is a major constituent of ribosomes - Found in nucleolus region of nucleus RNA Polymerase III (RNA Pol III): - Transcribes transfer RNA (tRNA) genes - Also transcribes 5S rRNA, some small nuclear RNAs - Transcripts are relatively short Key Differences: - RNA Pol II - mRNA transcription for protein synthesis - RNA Pol I/III - transcription of non-coding RNAs - Different promoter recognition and regulation mechanisms - RNA Pol II transcripts are extensively processed So in summary: - RNA Pol II for protein-coding mRNAs - RNA Pol I for large rRNA transcripts - RNA Pol III for small stable RNAs like tRNAs - Different roles but all essential for gene expression

Answer 55

The TATA box, also known as the Goldberg-Hogness box, is a DNA sequence found upstream (usually around 25-30 base pairs upstream) of the transcription start site of many eukaryotic genes. It consists of the sequence "TATAAA" or a similar variant. The TATA box serves as a binding site for the TATA-binding protein (TBP), a component of the transcription factor IID (TFIID) complex. Binding of TBP to the TATA box helps to initiate the assembly of the RNA polymerase II transcription initiation complex, facilitating the start of transcription. The TATA box is crucial for the accurate positioning of the transcriptional machinery and the regulation of gene expression.

Answer 56

The TATA-binding protein (TBP) is a key component of the transcription factor IID (TFIID) complex in eukaryotes. It binds specifically to the TATA box, a DNA sequence found upstream of many eukaryotic genes, and plays a central role in the initiation of transcription by RNA polymerase II. TBP helps recruit other transcription factors and RNA polymerase II to the promoter region of genes, facilitating the assembly of the pre-initiation complex and the initiation of transcription. It is essential for the accurate regulation of gene expression.

Answer 57

A general transcription factor is a protein involved in the initiation of transcription of protein-coding genes in eukaryotes. These factors are required for the assembly of the transcriptional machinery at the promoter region of genes. They include proteins like the TATA-binding protein (TBP) and other factors associated with RNA polymerase II. General transcription factors help to position RNA polymerase II correctly at the transcription start site and facilitate the initiation of transcription. They are essential for the transcription of most protein-coding genes and are distinct from regulatory transcription factors that bind to specific DNA sequences to modulate gene expression.

Answer 58

The pre-initiation complex (PIC) is a multi-protein complex that forms at the promoter region of a gene during the initiation stage of transcription in eukaryotes. It includes general transcription factors, such as TATA-binding protein (TBP), and other proteins that help to position RNA polymerase II and initiate transcription. The assembly of the pre-initiation complex is a crucial step in gene expression, marking the beginning of transcription of a specific gene.

Answer 59

The initiation complex refers to the ensemble of proteins assembled at the promoter region of a gene to initiate transcription. In prokaryotes, the initiation complex typically involves RNA polymerase along with sigma factor, which helps recognize the promoter sequence. In eukaryotes, the initiation complex includes RNA polymerase II, general transcription factors (such as TATA-binding protein and TFIIA, TFIIB, etc.), and other regulatory proteins. The formation of the initiation complex marks the beginning of transcription and is a key step in gene expression.

Answer 60

5' Capping: - 7-methylguanosine cap added to 5' end of nascent mRNA - Functions: - Protects mRNA from degradation - Assists nuclear export of mRNA - Recruits ribosomes for translation initiation 3' Polyadenylation: - Poly(A) tail of ~200 adenines added to 3' end - Functions: - Protects mRNA from degradation - Facilitates transport from nucleus - Enhances translation by stabilizing mRNA Splicing: - Removal of non-coding intron sequences from pre-mRNA - Joining of coding exon sequences into mature mRNA - Occurs in nucleus before mRNA export - Requires spliceosome complex of snRNPs and proteins Additional points: - All three processes occur in nucleus before export - Allow proper maturation and regulation of eukaryotic mRNAs - Increase stability, translation efficiency of mature transcripts - Splicing enables combination of exons, protein diversity

Answer 61

- Most eukaryotic genes contain multiple exons and introns - During splicing, different combinations of exons can be included in the mature mRNA - This produces multiple different mRNA transcripts from the same gene - Mechanisms of alternative splicing: - Exon skipping - certain exons are omitted - Mutually exclusive exons - only one of two exons is included - Alternative 5' or 3' splice sites are used - Intron retention - an intron may remain in the mRNA - Allows a single gene to code for multiple different protein isoforms - Expands the protein diversity encoded by the genome - Alternative splicing is tightly regulated - By splicing regulatory proteins - Binding of these proteins influences exon inclusion - Allows splicing to respond to developmental/environmental cues - Functions as a form of post-transcriptional gene regulation - Controls which protein isoforms are produced - Modulates protein function, localization, interactions - Very prevalent in humans, contributes to protein diversity - Up to 95% of human genes may undergo alternative splicing So in summary, alternative splicing is a crucial mechanism that allows production of multiple protein variants from one gene through differential exon inclusion.

Answer 62

1. siRNA and mRNA Stability (Post-Transcriptional Regulation): - siRNAs (small interfering RNAs) are ~20 nucleotides long - Derived from long double-stranded RNA precursors - The siRNA associates with the RISC complex - RISC uses siRNA as a guide to bind and cleave complementary mRNA targets - This degradation of the mRNA prevents its translation into protein - Acts as a post-transcriptional gene silencing mechanism 2. miRNA and Translation Inhibition (Post-Transcriptional Regulation): - miRNAs (microRNAs) are also ~22 nucleotides long - Derived from stem-loop precursors encoded in the genome - The miRNA associates with the RISC complex - RISC uses the miRNA to bind to partially complementary sites in 3'UTRs of mRNAs - This does not degrade the mRNA, but represses its translation into protein - Allows miRNAs to fine-tune protein output post-transcriptionally In both cases: - RNAi pathways involve small non-coding RNAs - These guide Argonaute-containing RISC complex to targets - Results in post-transcriptional regulation of gene expression - siRNAs degrade mRNAs, miRNAs inhibit translation without degradation So in summary, RNAi exploits small RNAs to regulate genes post-transcriptionally by either mRNA degradation (siRNA) or translational repression (miRNA).

Answer 63

Bacteria: - Many bacterial transcription factors contain helix-turn-helix motifs - The α-helices in this motif fit into the major groove of DNA - Specific amino acids make contacts with exposed DNA bases - This allows sequence-specific recognition of promoter regions Eukaryotes: - Eukaryotic transcription factors use several DNA binding motifs: - Zinc finger proteins - zinc ions help position α-helices in DNA major groove - Leucine zipper - dimerization allows recognition of longer sequences - Helix-loop-helix - HLH motifs bind DNA and allow dimerization - Other motifs like homeodomain, HMG box also facilitate DNA binding General Mechanisms: - α-Helices in the protein motifs are key for DNA major groove binding - Amino acid side chains make sequence-specific contacts with exposed bases - Dimerization of DNA binding domains increases binding specificity - Minor groove interactions and DNA bending also contribute Additional Points: - Cooperative binding with other proteins enhances specificity - Post-translational modifications can modulate DNA binding affinity - Chromatin structure impacts accessibility of binding sites in eukaryotes So in essence, DNA binding proteins use a variety of structural motifs that allow their α-helices and amino acids to specifically read out and bind target DNA sequences.

Answer 64

Regulatory Sequence Variation: - Mutations in promoter or enhancer/operator sequences - Can increase or decrease affinity for TF binding - Alters recruitment of transcription machinery and initiation frequency TF Affinity: - Determined by TF structure and DNA sequence motif - Higher affinity allows tighter TF binding to regulatory regions - Increases probability of initiation complex assembly TF Concentration: - Abundance of specific TFs is a major determinant - Higher TF levels increase occupancy at regulatory sequences - More efficient recruitment of polymerase for initiation In Bacteria: - Promoter mutations affect binding of σ factors and RNAP - Operator mutations modulate repressor/activator binding - TF levels controlled by regulation of their expression In Eukaryotes: - Promoter and enhancer mutations impact TF and coactivator binding - Variation in activation domains affects recruitment ability - TF levels controlled by complex regulatory mechanisms So in both systems, changes to regulatory sequences, TF-DNA binding affinities, and cellular TF concentrations can all be leveraged to fine-tune transcription initiation rates for different genes under different conditions.

Answer 65

Splicing is the process in eukaryotic cells by which introns, non-coding regions of a gene, are removed from the precursor messenger RNA (pre-mRNA) transcript and the exons, coding regions, are joined together to form mature mRNA. This process occurs in the cell nucleus and is catalyzed by the spliceosome, a complex of RNA and protein. Splicing is essential for generating functional mRNA transcripts that can be translated into proteins.

Answer 66

Alternative splicing is a process in eukaryotic gene expression where different combinations of exons within a pre-mRNA transcript can be joined together during splicing, resulting in multiple mRNA isoforms derived from a single gene. This process allows for the production of diverse protein products from a limited number of genes and contributes to cellular diversity and complexity. Alternative splicing can generate mRNA transcripts with different coding sequences, leading to proteins with distinct functions, localization, or regulatory properties.

Answer 67

An intron is a non-coding segment of a gene's DNA that is transcribed into pre-mRNA but is removed during RNA processing and does not appear in the final mRNA molecule. In eukaryotic cells, introns interrupt the coding sequences (exons) of genes and are spliced out during mRNA maturation. Although they do not encode protein sequences, introns can have regulatory functions and contribute to genetic diversity through alternative splicing.

Answer 68

An exon is a coding region of a gene's DNA that is transcribed into mRNA and appears in the final, mature mRNA molecule after introns have been removed during RNA processing. Exons contain sequences that encode specific amino acids, and they are joined together during splicing to form the coding sequence of the mRNA. Exons determine the protein-coding information of a gene and are crucial for synthesizing functional proteins.

Answer 69

The untranslated region (UTR) is a segment of mRNA (messenger RNA) that lies outside the coding sequence of a gene. It occurs both upstream (5' UTR) and downstream (3' UTR) of the coding region. While not translated into protein, UTRs play important roles in regulating gene expression, mRNA stability, and localization within the cell.

Answer 70

Pre-mRNA, or precursor messenger RNA, is an initial transcript produced during transcription in eukaryotic cells. It contains both exons (coding regions) and introns (non-coding regions). Pre-mRNA undergoes processing, including capping, splicing, and polyadenylation, to become mature mRNA. This processing involves the removal of introns and the addition of a 5' cap and a poly(A) tail. The mature mRNA is then transported to the cytoplasm for translation into protein.

Answer 71

Mature mRNA is the final processed form of mRNA that is ready for translation into protein in eukaryotic cells. It is derived from pre-mRNA through processing steps including capping, splicing, and polyadenylation. Mature mRNA contains only the exons (coding regions) of the gene and has a 5' cap structure and a poly(A) tail added to it. It serves as the template for protein synthesis during translation.

Answer 72

The 5' G-cap, also known as the 5' cap, is a modified nucleotide structure added to the 5' end of eukaryotic mRNA molecules during RNA processing. It consists of a guanine nucleotide linked to the mRNA via a 5'-5' triphosphate bridge, followed by additional methylations. The 5' cap plays crucial roles in mRNA stability, translation initiation, and mRNA export from the nucleus to the cytoplasm.

Answer 73

The poly(A) tail is a stretch of adenine nucleotides added to the 3' end of eukaryotic mRNA molecules during RNA processing. It typically consists of multiple adenine residues, forming a "tail" structure. The poly(A) tail plays important roles in mRNA stability, facilitating mRNA export from the nucleus, and enhancing translation efficiency. It also protects the mRNA from degradation by exonucleases.

Answer 74

RNA interference (RNAi) is a biological process in which small RNA molecules, such as small interfering RNA (siRNA) or microRNA (miRNA), regulate the expression of genes by inhibiting the translation of mRNA or by promoting the degradation of specific mRNA molecules. RNAi acts as a natural defense mechanism against viruses and transposons and also plays essential roles in regulating gene expression during development and in response to environmental stimuli.

Answer 75

Short interfering RNA (siRNA) is a class of small RNA molecules typically around 20-25 nucleotides in length. siRNAs are involved in the RNA interference (RNAi) pathway, where they mediate sequence-specific gene silencing by targeting complementary mRNA molecules for degradation or by inhibiting their translation. In experimental settings, synthetic siRNAs can be introduced into cells to specifically silence target genes, making them powerful tools for studying gene function and potential therapeutic agents for treating diseases caused by aberrant gene expression.

Answer 76

MicroRNA (miRNA) is a class of small non-coding RNA molecules typically around 21-25 nucleotides in length. miRNAs are involved in post-transcriptional regulation of gene expression by binding to complementary sequences in the 3' untranslated regions (UTRs) of target mRNA molecules. This binding can lead to mRNA degradation or inhibition of translation, thereby modulating the expression of target genes. miRNAs play critical roles in various biological processes, including development, differentiation, proliferation, and apoptosis, and dysregulation of miRNA expression has been implicated in many diseases, including cancer and neurodegenerative disorders.

Answer 77

The major groove is one of the two larger grooves found in the double helical structure of DNA, the other being the minor groove. It is characterized by a wider space between the two strands of the DNA helix and provides access to the nitrogenous bases of the nucleotides. The major groove is important for interactions with proteins, such as transcription factors and other DNA-binding proteins, which recognize specific sequences of DNA bases by fitting into and making contacts within this groove. It plays a crucial role in various cellular processes, including gene regulation, replication, and repair.

Answer 78

The minor groove is one of the two smaller grooves found in the double helical structure of DNA, the other being the major groove. It is characterized by a narrower space between the two strands of the DNA helix and provides access to the edges of the nitrogenous bases of the nucleotides. While not as spacious as the major groove, the minor groove still plays a significant role in DNA-protein interactions, as certain DNA-binding proteins can recognize specific DNA sequences by fitting into and making contacts within this groove. The minor groove is also involved in various cellular processes, including gene regulation, replication, and repair.

Answer 79

Affinity refers to the strength of interaction between two molecules, such as a ligand and a receptor, or an enzyme and its substrate. It quantifies how readily molecules bind to each other and is typically measured by the equilibrium binding constant (Kd) in biochemistry. High affinity indicates a strong binding interaction, with molecules staying bound for longer periods or requiring lower concentrations for binding, whereas low affinity indicates weaker binding, with molecules dissociating more readily or requiring higher concentrations for binding. Affinity plays a crucial role in various biological processes, including signal transduction, enzyme catalysis, and molecular recognition.

Answer 80

Bacteria: - Promoters for RNAP binding/initiation - Single RNAP enzyme - Sigma factors act as general TFs - No enhancers/silencers - Activators and repressors control transcription - Transcription elongation by RNAP alone - Rho-dependent or -independent termination - No post-transcriptional modifications like capping/polyadenylation - 5'/3' UTRs present but no splicing Eukaryotes: - Promoters with TF binding sites - 3 RNAP enzymes (I, II, III) - Multiple general TFs like TFIID - Enhancers and silencers regulate genes - Activators, repressors, chromatin factors - Transcription elongation involves many factors - Termination with poly(A) site, processing factors - 5' capping, 3' polyadenylation, splicing of introns - Long 5'/3' UTRs with regulatory roles Genome Features: - Bacterial genome is circular chromosome - Eukaryotic genome has linear chromosomes - Bacterial genes are simple, contiguous - Eukaryotic genes have split exon/intron structure In general, eukaryotic transcription has more protein factors involved and additional regulatory complexity from chromatin, RNA processing, and genome organization compared to the streamlined bacterial system.

Answer 81

Heterochromatin vs Euchromatin: - Heterochromatin is densely packed, transcriptionally inactive - Euchromatin is more open and accessible for transcription - Heterochromatin limits binding of transcription factors/machinery - Euchromatin allows transcriptional machinery access to DNA - Highly condensed heterochromatin marks genes for silencing - More open euchromatin structure permits active transcription Nucleosomal DNA vs Linker DNA: - Nucleosomes wrap DNA around histone octamers - The linker DNA between nucleosomes is more exposed - Transcription factors/complexes can more easily access linker DNA - Nucleosomal DNA is less accessible when wrapped on histones - Nucleosome positioning/remodeling exposes or hides sequences - Activating sequences preferentially located in linker regions Additional Regulation: - Histone modifications (acetylation, methylation) affect chromatin - ATP-dependent remodeling complexes alter nucleosome positioning - Higher order folding into chromatin fibers also impacts accessibility In summary: - Heterochromatin is restrictive while euchromatin permits transcription - Linker DNA is more accessible than nucleosomal DNA for binding - Chromatin remodeling and histone modifications regulate accessibility So the chromatin environment acts as a major regulator of transcription through modulating the physical accessibility of DNA sequences.

Answer 82

Histone Modifications and Chromatin Remodeling: - Histones can be covalently modified (e.g. acetylation, methylation) - These modifications alter the charge and structure of nucleosomes - Affect how tightly DNA is wrapped around histones - Recruit or prevent binding of chromatin remodelers/transcription factors - Histone acetylation generally leads to more open, transcriptionally active chromatin - Histone methylation can lead to active or inactive states depending on residue - ATP-dependent chromatin remodeling complexes can: - Slide or remove nucleosomes to expose DNA sequences - Regulate access of transcription machinery to genes - Histone modifications and chromatin remodeling control gene expression epigenetically Epigenetic Inheritance: - Epigenetic marks like DNA methylation and histone modifications are mitotically inherited - Patterns are propagated through cell divisions by enzymes - Allows stable propagation of gene expression states - In some cases, epigenetic states can be inherited transgenerationally - Allows transmission of environmentally-induced epi-mutations So in summary: - Epigenetics refers to heritable modifications that regulate gene expression - Without altering the underlying DNA sequence itself - Histone modifications and chromatin remodeling are key epigenetic mechanisms - Epigenetic information can be mitotically and sometimes transgenerationally inherited

Answer 83

Euchromatin is a loosely packed form of chromatin found in the nucleus of eukaryotic cells. It is characterized by a more open and accessible structure, allowing for active gene transcription and gene expression. Euchromatin is typically associated with genes that are actively transcribed to produce RNA, and it contains a higher density of genes and regulatory elements compared to heterochromatin. The less condensed nature of euchromatin facilitates the binding of transcription factors and other regulatory proteins to DNA, enabling efficient gene expression.

Answer 84

Heterochromatin is a densely packed form of chromatin found in the nucleus of eukaryotic cells. It is characterized by a tightly condensed structure, which makes it less accessible for gene transcription and gene expression. Heterochromatin is typically associated with regions of the genome that are transcriptionally inactive or contain repetitive DNA sequences, such as centromeres and telomeres. The condensed nature of heterochromatin prevents the binding of transcription factors and other regulatory proteins to DNA, thereby silencing gene expression in these regions.

Answer 85

A nucleosome is the fundamental unit of chromatin, the complex of DNA and proteins that make up chromosomes in eukaryotic cells. It consists of a segment of DNA wrapped around a core of histone proteins. The core histones, comprising two copies each of histones H2A, H2B, H3, and H4, form an octamer around which approximately 147 base pairs of DNA are wound in about 1.65 turns. Nucleosomes serve to compact and organize the long strands of DNA within the cell nucleus and play crucial roles in gene regulation, DNA replication, and repair.

Answer 86

Histones are a family of highly conserved proteins found in eukaryotic cell nuclei. They are responsible for packaging and organizing DNA into structural units called nucleosomes, which form the building blocks of chromatin. Histones play a crucial role in regulating gene expression by controlling access to DNA and influencing chromatin structure. They have a high density of positively charged amino acids, allowing them to interact with the negatively charged phosphate backbone of DNA. In addition to their structural role, histones can undergo various post-translational modifications, such as acetylation, methylation, and phosphorylation, which further regulate chromatin structure and gene expression.

Answer 87

Nucleosomal DNA refers to the DNA segment that is wrapped around the histone octamer core to form a nucleosome. It consists of approximately 147 base pairs of DNA that are wound around the histone proteins in about 1.65 turns. Nucleosomal DNA plays a crucial role in the organization and compaction of chromatin structure within the cell nucleus. Additionally, it is subject to various epigenetic modifications and influences gene expression by regulating the accessibility of DNA to transcription factors and other regulatory proteins.

Answer 88

Linker DNA, also known as linker histone, refers to the DNA segment that connects adjacent nucleosomes in chromatin. It is the stretch of DNA that extends between two nucleosomes and is not tightly wrapped around histone proteins. Linker DNA contributes to the higher-order organization of chromatin by providing flexibility and allowing nucleosomes to be spaced apart. It also plays a role in regulating chromatin structure and gene expression by influencing the accessibility of DNA to regulatory proteins.

Answer 89

Condensed chromatin refers to regions of chromatin that are tightly packed and highly compacted within the cell nucleus. It is characterized by a dense arrangement of nucleosomes and other associated proteins, resulting in limited accessibility of the DNA to transcription factors and other regulatory proteins. Condensed chromatin is typically transcriptionally inactive and is often associated with heterochromatic regions of the genome, such as centromeres and telomeres. The compaction of chromatin into condensed structures helps to organize and protect the genome and plays a role in regulating gene expression and other nuclear processes.

Answer 90

Decondensed chromatin refers to regions of chromatin that are less compacted and more open within the cell nucleus compared to condensed chromatin. It is characterized by a looser arrangement of nucleosomes and other associated proteins, allowing for increased accessibility of the DNA to transcription factors and other regulatory proteins. Decondensed chromatin is often associated with transcriptionally active regions of the genome, where genes are actively transcribed to produce RNA. The relaxation of chromatin structure into a decondensed state facilitates gene expression and other nuclear processes such as DNA replication and repair.

Answer 91

Methylation is a biochemical process where a methyl group (CH3) is added to a molecule, typically occurring on DNA, RNA, proteins, or small molecules. In the context of DNA, DNA methylation involves the addition of a methyl group to the cytosine base of DNA, typically at cytosine-phosphate-guanine (CpG) dinucleotide sites. DNA methylation plays a crucial role in regulating gene expression, genome stability, and chromatin structure. In gene regulation, methylation of CpG islands in gene promoter regions can lead to transcriptional repression by inhibiting the binding of transcription factors or recruiting proteins involved in gene silencing. In addition to DNA, methylation can also occur on histone proteins and RNA molecules, influencing various cellular processes and gene expression patterns.

Answer 92

Acetylation is a biochemical process in which an acetyl group (-COCH3) is added to a molecule, typically occurring on proteins or histone proteins. In the context of histone proteins, acetylation involves the addition of an acetyl group to the lysine residues of histone tails. This modification is catalyzed by histone acetyltransferase (HAT) enzymes. Histone acetylation is associated with relaxed chromatin structure and increased gene expression, as it neutralizes the positive charge of lysine residues, weakening the interaction between histones and DNA, and facilitating access of transcription factors to DNA. Acetylation of non-histone proteins, such as transcription factors, can also regulate their activity and stability, influencing gene expression and various cellular processes.

Answer 93

Chromatin remodeling refers to the dynamic process by which the structure of chromatin, the complex of DNA and proteins in the nucleus of eukaryotic cells, is altered to regulate gene expression and other nuclear processes. It involves the repositioning, eviction, or restructuring of nucleosomes along the DNA, thereby modulating the accessibility of DNA to transcription factors and other regulatory proteins. Chromatin remodeling complexes, such as ATP-dependent chromatin remodelers, use energy from ATP hydrolysis to drive the movement or restructuring of nucleosomes, allowing for changes in chromatin organization and gene regulation. Chromatin remodeling plays crucial roles in diverse biological processes, including transcriptional activation and repression, DNA repair, and genome stability.

Answer 94

HAT stands for Histone Acetyltransferase. It is an enzyme that catalyzes the addition of an acetyl group (-COCH3) to lysine residues on histone proteins. This process, known as histone acetylation, typically occurs on the N-terminal tails of histones and is associated with relaxed chromatin structure and increased gene expression. HAT enzymes play a crucial role in regulating gene expression by modifying chromatin structure, making DNA more accessible to transcription factors and other regulatory proteins. They are involved in various cellular processes, including development, differentiation, and response to environmental cues.

Answer 95

HDAC stands for Histone Deacetylase. It is an enzyme that catalyzes the removal of acetyl groups from lysine residues on histone proteins. This process, known as histone deacetylation, typically results in a more condensed chromatin structure and decreased gene expression. HDAC enzymes play a crucial role in gene regulation by reversing the effects of histone acetylation, leading to transcriptional repression. They are involved in various cellular processes, including development, differentiation, and response to environmental cues. HDAC inhibitors have been studied as potential therapeutics for various diseases, including cancer and neurodegenerative disorders, due to their ability to modulate gene expression patterns.

Answer 96

HMT stands for Histone Methyltransferase. It is an enzyme responsible for catalyzing the addition of methyl groups (-CH3) to lysine or arginine residues on histone proteins. This process, known as histone methylation, can result in different outcomes depending on the specific amino acid residue modified and the number of methyl groups added. Histone methylation can either activate or repress gene expression, depending on the site and degree of methylation, and is involved in regulating various cellular processes, including development, differentiation, and disease. HMTs play crucial roles in establishing and maintaining histone methylation patterns, which contribute to the epigenetic regulation of gene expression.

Answer 97

a) transcription factor binding to regulatory elements for initiation b) elongation

Answer 98

b) euchromatin

Answer 99

demethylases (removes)

Answer 100

Transcription (all at initiation) - chromatin accessibility of the gene *euk only (though bac do have ”chromatin”) - DNA methylation *both - activators, repressors, silencers, enhancers, operators *both Post-transcriptional - alternative splicing of mRNA *euk only - mRNA modification *both - but polyA and 5’cap are *euk only -5’ and 3’ UTR regulation *both - small nc-RNAs binding to UTRs *both but siRNA only euk.

Answer 101

Transcription Initiation: - Regulated by promoter sequences and bound transcription factors - Chromatin accessibility controlled by histone modifications/remodeling - e.g. H3K9ac increases accessibility, H3K9me3 decreases accessibility - DNA looping brings distal enhancers/silencers into proximity of promoters - Concentrations and activities of transcription factors modulate initiation Elongation: - Regulated by elongation factors and chromatin structure - Histone modifications affect elongation efficiency - e.g. H3K36me3 prevents initiation in gene bodies - Chromatin remodelers clear nucleosomes for polymerase progression Termination: - Regulated by terminator sequences, poly(A) signals - Proper chromatin context required for termination factors to bind RNA Processing: - 5' capping, 3' polyadenylation, splicing are regulated - Splicing regulated by splicing factors binding signals in RNA - Alternative splicing expands protein diversity Epigenetic Regulation: - Histone modifications and DNA methylation control chromatin state - Inherited patterns maintain active/repressed expression states - Chromatin remodelers expose or conceal regulatory regions So in summary, every stage of eukaryotic gene expression is subject to multiple layers of regulation, with chromatin structure and epigenetic marks playing a central role in modulating accessibility and recruitment of the required machinery.

Answer 102

Triplet Nucleotide Codons: - The genetic code is read in triplets of 3 nucleotides (codons) - Each codon specifies a particular amino acid or stop signal Redundancy: - Multiple codons can code for the same amino acid - This redundancy is described as the code being degenerate Non-ambiguity: - Each codon specifies only one amino acid (or stop) - The code has no ambiguity in its meanings Universality: - The genetic code is nearly universal across all living organisms - A few exceptions in certain viruses/prokaryotes Wobble Position: - The third position of a codon is more flexible in base-pairing - Allowssome non-canonical base pairings (wobble) Reading Frame: - The codons are read in a continuous sequence without overlaps - Frameshifts result in completely different proteins Point Mutations: - Missense - Single nucleotide change results in different amino acid - Nonsense - Single nucleotide change introduces premature stop codon - Silent - Single nucleotide change has no effect on amino acid - Frameshift - Insertion/deletion shifts reading frame of all codons after So in summary: Triplet codons, redundancy, non-ambiguity, near universality, wobble in third position, maintenance of continuous reading frame, and potential for different point mutation types are key features of the genetic code.

Answer 103

demethylase and acetyltransferase

Answer 104

Each step from DNA to functional product can be regulated to allow cells to - specialize - conserve energy by not making unneeded products - change in response to conditions

Answer 105

-very much like a translator: one end anticodon which complementary to the codon and the other end has the corresponding amino acid Ex: Arg-tRNA has Arginine anticodon of 5’UCG and Arg amino acid attached to 3’ end

Answer 106

This serine tRNA can recognize both 5’ UCC and 5’ UCU codons. So two different codons give same amino acid = redundancy Base pairing in the 3’ mRNA position can be non-standard with the 5’ tRNA anticodon. This allows fewer tRNAs to accommodate all 61 codons and gives redundancy in the code

Answer 107

* tRNA transcribed in nucleus, exported to cytoplasm * Need to get correct amino acid attached to tRNA with correct anticodon * Aminoacyl-tRNA synthetase (enzyme!) matches tRNA to correct amino acid * 20 synthetases – one for each 20 aa * Recognize anticodon and aa * Aminoacyl-tRNA or a charged tRNA – is tRNA with its amino acid attached

Answer 108

Initiation in Bacteria: - Ribosome binding site on mRNA recruits small ribosomal subunit - Start codon (AUG) on mRNA is recognized - Initiation factors assist binding of initiator tRNA to start codon - Small subunit joins with large subunit around mRNA - Forms complete 70S initiation complex ready for elongation Initiation in Eukaryotes: - 5' cap on mRNA recruits small 40S ribosomal subunit - Scanning for start codon (AUG) facilitated by initiation factors - Initiator Met-tRNA binds to start codon in 40S subunit - Large 60S subunit joins, forming complete 80S initiation complex - Additional initiation factors required compared to bacteria Key Components: - mRNA with ribosome binding site/start codon - Small and large ribosomal subunits - Initiator aminoacyl-tRNA (Met-tRNA or fMet-tRNA) - Initiation factors assist recruitment and joining So in essence, the initiation phase involves the recruitment of the ribosomal subunits and initiator tRNA to the start codon of the mRNA, facilitated by initiation factors, to form the completed translation initiation complex.

Answer 109

Shine-Dalgarno Seq binds ribosome through complementary bp 5’-methyl-Gcap f-Met first AUG Rest of AUGs are Met Normal Methionine

Answer 110

A – aminoacyl-tRNA site 4. next aminoacyl-tRNA enters & binds codon P – peptidyl-tRNA site 5. Peptidyl transferase activity catalyzes peptide bond between the existing polypeptide chain in P site to the amino acid in A site. The polypeptide will be attached to the tRNA in the A site E – exit 6. Ribosome moves down mRNA, now the ”empty” tRNA P (it’s not aminoacyl tRNA anymore) is going to be moved to the E site displacing the previous tRNA All same bacteria & eukaryotes.

Answer 111

When a stop codon is encountered a release factor enters the ribosome and causes it to release the peptide and disassemble Release factor is a PROTEIN!

Answer 112

Initiation: 1) Ribosome Binding - Small ribosomal subunit binds to Ribosome Binding Site (RBS) on mRNA 2) Start Codon Recognition - Start codon (AUG) on mRNA is recognized 3) Initiator tRNA Binding - Initiator tRNA (Met-tRNAi or fMet-tRNA) binds to start codon 4) Large Subunit Joining - Large ribosomal subunit joins, forming complete initiation complex Elongation: 1) Aminoacyl-tRNA Entry - Aminoacyl-tRNA corresponds to next codon enters A-site 2) Peptide Bond Formation - Peptide bond formed, adding new amino acid to polypeptide 3) Translocation - Ribosome moves one codon along, deacylated tRNA exits E-site 4) Repeat of 1-3 until stop codon reached Termination: 1) Stop Codon in A-site - A stop codon (UAA, UGA, or UAG) enters the A-site 2) Release Factor Binding - Release factor binds and hydrolyzes peptidyl-tRNA bond 3) Polypeptide Release - Completed polypeptide is released from the ribosome 4) Ribosome Recycling - Subunits dissociate, preparing for next translation cycle So in summary - initiation involves start codon recognition and ribosome assembly, elongation cycles of decoding, peptide bond formation and translocation, and termination triggered by stop codons to release the completed polypeptide.

Answer 113

Bacteria: - The small 30S ribosomal subunit directly binds to the Ribosome Binding Site (RBS) on the mRNA - The RBS is a purine-rich sequence around 8 nucleotides upstream of the start codon - This direct RBS binding helps recruit the small subunit to the correct start site Eukaryotes: - The small 40S subunit first binds to the 5' cap of the mRNA - It then scans along the mRNA linearly in a 5' to 3' direction - Aided by initiation factors like eIF4, the 40S subunit searches for the start codon - No RBS sequence, the start codon itself is recognized during scanning Additional Points: - In bacteria, RBS interaction helps simple positioning of 30S at start - In eukaryotes, more complex scanning and start codon recognition mechanism - More initiation factors required in eukaryotes to facilitate this process - But the overall initiation complex assembly is conceptually similar So the key difference is that bacterial mRNAs have a RBS that the small subunit directly recognizes and binds, while eukaryotic initiation relies on 5' cap binding followed by linear scanning along the mRNA to locate the start codon.

Answer 114

Here is a labeled diagram of a tRNA (transfer RNA) molecule with its key parts: ``` 5' End ________________________________________________ | | | ______ | | / \ | | / \ | | | | | | | | Anticodon | | | __\___ ||| | | | / \ XXX | | | / \ | | | \ / | | | \______/ | | | | | | | |________|____________ ______________| \ / \ / \ / \ / | | | | Amino Acid Attachment Site | 3' End ``` Key Parts: - 5' End and 3' End - Ends of the tRNA molecule - Anticodon - A triplet sequence of 3 nucleotides that base pairs with the complementary codon on mRNA - Amino Acid Attachment Site - The site where the specific amino acid is covalently attached to the tRNA - Cloverleaf structure - The tRNA folds into this cloverleaf secondary and tertiary structure During translation, the anticodon of the charged aminoacyl-tRNA base pairs with the codon on the mRNA in the ribosome's A-site. This allows the correct amino acid attached to the 3' end of the tRNA to be added to the growing polypeptide chain.

Answer 115

Here are the key points about the tRNA charging process involving tRNA synthetases: Role of tRNA Synthetases: - Enzymes that attach the correct amino acid to its corresponding tRNA molecule - One specific tRNA synthetase exists for each amino acid Charging Process: 1) tRNA synthetase binds to its cognate tRNA 2) It recognizes and binds the appropriate amino acid 3) A bond is formed between the amino acid and the 3' end of the tRNA 4) This joins the amino acid to the tRNA, producing an aminoacyl-tRNA or charged tRNA Specificity Mechanisms: - Each tRNA synthetase has a specific amino acid binding pocket - It selects the correct amino acid based on size, shape, chemical properties - It also has an anticodon-binding domain to recognize the appropriate tRNA Double-Sieve Mechanism: - The active site acts like a double sieve or filter - The smaller sieve excludes amino acids too large - The larger sieve stops amino acids that are too small Error Checking: - Proofreading mechanisms check the amino acid is correctly attached - Incorrectly charged tRNAs are hydrolyzed and released - Ensures fidelity of the charging process So in summary, extremely specific tRNA synthetases catalyze the attachment of the correct amino acids to their corresponding tRNA molecules through a high-fidelity, error-checked charging reaction.

Answer 116

A codon is a sequence of three nucleotides (triplet) in mRNA that corresponds to a specific amino acid or serves as a start or stop signal during protein synthesis. Each codon encodes a specific amino acid, except for three codons (UAA, UAG, and UGA) that serve as stop signals, terminating translation. The genetic code, which is the set of rules by which nucleotide sequences are translated into amino acid sequences, dictates the correspondence between codons and amino acids. Codons are read sequentially during translation by the ribosome, with each codon specifying the addition of a specific amino acid to the growing polypeptide chain.

Answer 117

Redundancy in genetics means that multiple codons can code for the same amino acid, providing flexibility and robustness in protein synthesis.

Answer 118

Universality in genetics refers to the fact that the genetic code, the set of rules that translate nucleotide sequences into amino acid sequences, is nearly identical across all living organisms. This means that the same codons typically code for the same amino acids in diverse species, from bacteria to humans. This universality of the genetic code underscores the fundamental unity of life and allows for the exchange of genetic information between different organisms through processes such as horizontal gene transfer and genetic engineering.

Answer 119

The wobble position refers to the third nucleotide position in a codon. It is called "wobble" because there is flexibility in base pairing between the third nucleotide of the codon and the corresponding nucleotide in the anticodon of the tRNA molecule during translation. This flexibility allows a single tRNA to recognize multiple codons that code for the same amino acid, enhancing the efficiency of protein synthesis.

Answer 120

The reading frame is the specific way nucleotides in mRNA are grouped into codons during translation, crucial for accurate protein synthesis.

Answer 121

The small ribosomal subunit is a component of the ribosome responsible for binding to mRNA during translation.

Answer 122

The large ribosomal subunit is a component of the ribosome responsible for catalyzing the formation of peptide bonds during translation.

Answer 123

The Shine-Dalgarno sequence is a short nucleotide sequence found in prokaryotic mRNA molecules, usually located upstream of the start codon (AUG). It functions as a ribosome binding site, allowing the ribosome to recognize and initiate translation at the correct position on the mRNA.

Answer 124

tRNA, or transfer RNA, is a type of RNA molecule responsible for transporting specific amino acids to the ribosome during protein synthesis (translation). Each tRNA molecule carries a specific amino acid at one end and contains a three-nucleotide sequence called an anticodon at the other end, which base-pairs with the corresponding codon on mRNA. tRNA plays a crucial role in deciphering the genetic code and ensuring that the correct amino acids are incorporated into the growing polypeptide chain during translation.

Answer 125

The anticodon is a sequence of three nucleotides found on transfer RNA (tRNA) molecules. It pairs with a complementary codon on messenger RNA (mRNA) during translation, ensuring that the correct amino acid is added to the growing polypeptide chain.

Answer 126

tRNA synthetase is an enzyme responsible for attaching specific amino acids to their corresponding transfer RNA (tRNA) molecules during protein synthesis. This process, known as aminoacylation or tRNA charging, ensures that the correct amino acid is loaded onto the appropriate tRNA molecule, facilitating accurate translation of the genetic code.

Answer 127

Charged tRNA, also known as aminoacyl tRNA, is a transfer RNA (tRNA) molecule that has been covalently attached to its corresponding amino acid by an enzyme called aminoacyl-tRNA synthetase. The amino acid is linked to the 3' end of the tRNA molecule, forming an aminoacyl-tRNA complex. Charged tRNA molecules are crucial for protein synthesis, as they deliver the correct amino acid to the ribosome during translation, ensuring the accurate incorporation of amino acids into the growing polypeptide chain.

Answer 128

Release factor is a protein that binds to the ribosome during translation termination. It promotes the hydrolysis of the bond between the final tRNA molecule and the completed polypeptide chain, releasing the newly synthesized protein from the ribosome.

Answer 129

The E site, or exit site, is a ribosomal site where a transfer RNA (tRNA) molecule exits the ribosome after donating its amino acid during translation.

Answer 130

The P site, or peptidyl site, is a ribosomal site where the tRNA molecule carrying the growing polypeptide chain is located during translation.

Answer 131

The A site, or aminoacyl site, is a ribosomal site where a charged tRNA molecule binds during translation, bringing in the next amino acid to be added to the growing polypeptide chain.

Answer 132

A polypeptide is a linear chain of amino acids linked together by peptide bonds. It is a precursor to a protein and can fold into a specific three-dimensional structure to perform a particular biological function. Polypeptides are synthesized during translation, where amino acids are joined together in a specific sequence dictated by the mRNA template. Multiple polypeptide chains can associate to form a functional protein molecule.

Answer 133

A peptide bond is a covalent bond that forms between the amino group (-NH2) of one amino acid and the carboxyl group (-COOH) of another amino acid during protein synthesis. This bond forms through a condensation reaction, resulting in the loss of a water molecule. Peptide bonds link amino acids together to form polypeptide chains, which are the building blocks of proteins.

Answer 134

An amino acid is a small organic molecule that serves as the building block of proteins. It contains an amino group (-NH2), a carboxyl group (-COOH), and a side chain (R group) attached to a central carbon atom. There are 20 standard amino acids commonly found in proteins, each with a unique side chain that determines its chemical properties. Amino acids are linked together by peptide bonds to form polypeptide chains during protein synthesis. They play essential roles in various biological processes, including enzyme catalysis, cell signaling, and structural support.

Answer 135

Translation Steps: 1) Identify the start codon (AUG) - this indicates the reading frame 2) Split the sequence into triplet codons starting from the start codon 3) Use codon table to look up each codon and write down the corresponding amino acid 4) Continue until you reach a stop codon (UAA, UGA, UAG) 5) The amino acid sequence is the translation of that coding sequence Mutation Identification: If provided a mutant sequence: 1) Translate the original and mutant sequences 2) Compare amino acid sequences to identify the changed amino acid(s) 3) Determine the codon change that led to the amino acid change 4) Categorize the mutation type: - Missense - Single nucleotide change resulting in different amino acid - Nonsense - Single nucleotide change introducing premature stop codon - Silent - Single nucleotide change with no amino acid change - Insertion/Deletion - Frameshift mutation altering all codons after Example: Original: 5'- AUGGCCUUGGAC -3' Met Ala Leu Asp Mutant: 5'- AUGGCCUUAGAC -3' Met Ala STOP This is a nonsense mutation, where a single C->A change in the 3rd codon (UGG->UGA) introduces a premature stop codon. So in summary, translate using the codon table, identify differences versus a mutant sequence, and categorize as missense/nonsense/silent/frameshift.

Answer 136

tRNA Abundance: - Different tRNA species are present in varying abundances in the cell - Highly abundant tRNAs can more rapidly deliver their amino acids during translation - Limiting tRNA abundances for particular codons can slow down that codon's translation Codon Usage: - Codons for the same amino acid are not used equally in gene sequences - Some synonymous codons are used more frequently than others - Codon usage is biased and varies between organisms and gene sequences Codon Bias: - In any gene, some synonymous codons are used more frequently - This bias matches the most abundant tRNA species in the cell - Allows more efficient and rapid translation of these abundant codons Effects on Translation Rate: - Regions with abundant tRNAs/preferred codons are translated faster - Regions with rare tRNAs/codon bias are translated more slowly - This can create "ramps" or "peaks" of slower translation rates - Believed to help with protein folding, localization, regulation So in essence, the abundance of tRNA isoacceptors, the codon usage patterns of genes, and the resulting codon biases together influence the speed at which codons are translated, allowing regulation of translation elongation rates for different regions.

Answer 137

Shape/Conformation: - Phosphorylation can induce conformational changes by adding charged groups - Disulfide bonds formed by oxidation stabilize protein folding - Prolyl isomerization changes the shape around proline residues Activity: - Phosphorylation often activates or inactivates enzymes - Acetylation can increase or decrease protein binding affinities - Lipidation (e.g. prenylation) can activate membrane-bound proteins - Glycosylation modulates activity of extracellular proteins Localization: - Lipidation targets proteins to cell membranes - Glycosylation aids protein targeting to organelles like ER/Golgi - Nuclear localization signals direct nuclear import after acetylation Stability: - Ubiquitination marks proteins for proteasomal degradation - Methylation can protect proteins from degradation - Deamidation and oxidation often destabilize proteins Multiple PTMs can work together: - A protein may require several coordinated modifications for full regulation - e.g. Phosphorylation primes substrate for subsequent ubiquitination Histones and Chromatin: - Histone tails are heavily modified by acetylation, methylation, phosphorylation - These PTMs regulate chromatin compaction and gene expression So in summary, a wide array of covalent PTMs act as molecular switches, altering protein properties like shape, binding, localization and half-life in a dynamic and combinatorial fashion, including on histone proteins.

Answer 138

Codon usage bias refers to the tendency for certain codons to be used more frequently than others in the genetic code of an organism.

Answer 139

A rare codon is a codon that is used less frequently than other synonymous codons for encoding the same amino acid within the genetic code of an organism.

Answer 140

A common codon is a codon that is used more frequently than other synonymous codons for encoding the same amino acid within the genetic code of an organism.

Answer 141

Post-translational modification refers to the chemical modification of proteins after they have been synthesized by ribosomes during translation. These modifications can include the addition of functional groups such as phosphate, methyl, acetyl, or lipid groups, as well as cleavage of specific peptide bonds or the attachment of sugar moieties (glycosylation). Post-translational modifications play crucial roles in regulating protein function, stability, localization, and activity, and they are involved in various cellular processes, including cell signaling, metabolism, and gene expression.

Answer 142

Phosphorylation is a post-translational modification process in which a phosphate group (-PO4) is added to a protein molecule, typically to a serine, threonine, or tyrosine residue. This modification is catalyzed by enzymes called protein kinases and plays a key role in regulating protein function and cellular signaling pathways. Phosphorylation can affect protein activity, stability, subcellular localization, and interactions with other molecules, thereby influencing various cellular processes such as cell growth, proliferation, differentiation, and apoptosis.

Answer 143

Acetylation is the addition of an acetyl group (-COCH3) to a molecule, often proteins, through a post-translational modification process.

Answer 144

Methylation is the addition of a methyl group (-CH3) to a molecule, such as DNA, RNA, proteins, or small molecules, through a post-translational modification process.

Answer 145

Ubiquitination is a post-translational modification process in which a small protein called ubiquitin is covalently attached to a target protein, typically marking it for degradation by the proteasome or regulating its activity, localization, or interactions with other proteins. Ubiquitination is catalyzed by a cascade of enzymes, including ubiquitin-activating enzymes (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin ligases (E3). It plays crucial roles in regulating various cellular processes, including protein degradation, DNA repair, cell cycle progression, and signal transduction.

Answer 146

A kinase is an enzyme that adds a phosphate group to a substrate, typically a protein, nucleotide, or lipid.

Answer 147

A phosphatase is an enzyme that removes a phosphate group from its substrate, typically a protein, nucleotide, or lipid.

Answer 148

A ubiquitin ligase is an enzyme that catalyzes the attachment of ubiquitin molecules to target proteins, marking them for degradation or altering their function, localization, or interactions.

Answer 149

A deubiquitinating enzyme (DUB) is an enzyme that removes ubiquitin molecules from proteins, reversing the ubiquitination process.

Answer 150

1. Initiation - Origins of replication are recognized and bound by initiator proteins - Helicase unwinds the DNA double helix, forming a replication bubble - Single-stranded binding proteins (SSBs) bind and stabilize the unwound strands 2. Primer Synthesis - RNA primase synthesizes an RNA primer complementary to each parental strand 3. Elongation - DNA polymerase III (bacteria) or polymerases α, δ, ε (eukaryotes) bind to primers - Polymerases synthesize new complementary daughter strands in 5' to 3' direction - On leading strand, synthesis is continuous - On lagging strand, synthesis occurs in short Okazaki fragments 4. Ligation - On lagging strand, DNA ligase seals nicks between Okazaki fragments 5. Termination - Two replication forks meet and replication is complete - Specific termination sequences allow displacement of final RNA primer 6. Primer Removal and Filling of Gaps - RNA primers are removed by RNase H and DNA polymerase - Gaps are filled and nicks sealed by DNA polymerase and DNA ligase So in summary: Initiation at origins, primer synthesis, polymerase elongation on leading/lagging strands, Okazaki fragment ligation, termination when forks meet, and processing of primers/gaps to complete replication.

Answer 151

Specifically: 1) DNA polymerases can only synthesize DNA in the 5' to 3' direction by adding deoxynucleotides to the 3'-OH end of an existing strand. 2) At the start of replication, there is no pre-existing 3'-OH onto which the polymerase can add nucleotides. 3) To provide this initial 3'-OH group, a short RNA primer is synthesized by the primase enzyme. 4) The RNA primer has a free 3'-OH end that the DNA polymerase can then extend from by adding DNA nucleotides complementary to the template strand. 5) RNA is used instead of DNA because only RNA polymerases can initiate de novo synthesis. DNA polymerases cannot start without a pre-existing strand. 6) Once elongation begins, the DNA polymerase can continue adding DNA nucleotides in the 5'->3' direction using the parental template. So in essence, an RNA primer provides the free 3'-OH end that DNA polymerases require to initiate DNA synthesis, since they cannot start de novo. The RNA primer is extended by DNA nucleotides and is later removed and replaced.

Answer 152

* DNA replication is semi-conservative - each new double helix has one old and one new strand * DNA polymerase can only synthesize new DNA in the 5' to 3' direction * Leading strand is synthesized continuously by DNA polymerase moving along with replication fork * Lagging strand is synthesized discontinuously in short Okazaki fragments due to antiparallel orientation * DNA polymerase requires an RNA primer to initiate synthesis of each Okazaki fragment * RNA primers are laid down by primase enzyme and extended into Okazaki fragments by DNA polymerase * Later, RNA primers are removed and gaps filled by DNA polymerase, then sealed by DNA ligase * This process creates slightly more work and potential for errors on the lagging strand

Answer 153

Initiation: * Bacteria - Single origin of replication (ori) on circular chromosome * Eukaryotes - Multiple origins of replication (ori) on linear chromosomes Elongation: * Bacteria - One DNA polymerase III holoenzyme handles leading and lagging strands * Eukaryotes - Different polymerases for leading (pol ε) and lagging (pol δ) strands Termination: * Bacteria - Termination occurs when two replication forks meet and terminate * Eukaryotes - Termination zones lacking specific termination sequences, forks dissociate randomly

Answer 154

Initiation: - Origin of Replication (ori) - Helicase (unwinds DNA double helix) - Single-Stranded DNA Binding Proteins (ssb) (bind to unwound DNA, preventing rewinding) - Primase (lays down RNA primers on lagging strand template) Elongation: - Leading Strand - DNA Polymerase III (synthesizes continuously) - Lagging Strand: - DNA Polymerase III (extends from RNA primer, forming Okazaki fragments) - RNA Primer (allows Pol III to initiate synthesis) - DNA Ligase (seals nicks between Okazaki fragments after RNA primers removed) Termination: - Two Replication Forks meet and terminate Other Proteins: - Topoisomerase (relieves torsional strain ahead of replication forks) - RNase H (removes RNA primers) - DNA Polymerase I (replaces RNA primers with DNA)

Answer 155

Hayflick Limit: - Limits the number of times a cell population can divide - Cultured human cells can only divide 40-60 times - Cellular senescence occurs after this limit End Replication Problem: - DNA polymerase cannot completely replicate the ends of linear chromosomes - It leaves a short overhanging sequence at the 5' end unreplicated - This causes chromosomes to shorten with each division cycle Why it Occurs: - DNA polymerase requires an RNA primer to initiate replication - RNA primers are removed, leaving a gap at the 5' end - On linear DNA, there is no way to replace the sequence lost from the 5' end - Repeated rounds lead to progressive shortening of telomeres until critically short - This triggers cellular senescence at the Hayflick Limit

Answer 156

* During DNA replication, DNA polymerase cannot completely replicate the ends of linear chromosomes * A small portion at the 5' end remains unreplicated after removal of the RNA primer * With each cell division cycle, this unreplicated portion gets progressively shorter * This causes the telomeres (chromosome ends) to shorten with every round of replication * Telomeres protect the coding regions of the chromosome from being truncated * As telomeres shorten, coding sequences start getting deleted, making cell inviable * Once telomeres become critically short, cells trigger replicative senescence (Hayflick Limit) * This permanently arrests cell division to avoid genomic instability * The progressive shortening of telomeres due to the end replication problem is a cellular molecular clock * It limits how many times a cell can divide before losing viability * This has implications in aging, stem cell replicative potential, and cancer development So in summary, the end replication problem causes telomere attrition with each division cycle, ultimately limiting the number of times a cell can replicate before losing chromosome integrity and viability.

Answer 157

Telomeres: - Repetitive, non-coding sequences at the ends of linear chromosomes - Consist of same short DNA sequence repeats bound by shelterin protein complex - In humans, telomeres are TTAGGG repeats ranging from 8-15 kilobases long Functions of Telomeres: - Protect coding DNA at chromosome ends from degradation and fusion events - Distinguish natural chromosome ends from DNA double-strand breaks - Allow complete replication of coding DNA by providing disposable overhangs Telomeres and the Hayflick Limit: - With each cell division, telomeres shorten due to the end replication problem - Cells divide until telomeres erosion reaches a critical short length - Extremely short telomeres trigger DNA damage response pathways - This permanently arrests the cell cycle, causing replicative senescence - The progressive shortening of telomeres acts as a cellular "replicative clock" - Telomere length dictates the maximum number of divisions (Hayflick Limit) So telomeres prevent genome instability, but their shortening with each replication cycle limits how many times a cell can divide before losing viability and hitting the Hayflick Limit of cellular senescence.

Answer 158

Here's an explanation of how the enzyme telomerase lengthens telomeres: * Telomerase is a specialized reverse transcriptase enzyme that adds telomeric repeats to the ends of chromosomes. * It contains an RNA template complementary to the telomere repeat sequence (e.g. TTAGGG in humans). * Telomerase carries its own RNA that provides a template to extend the 3' overhang of the telomere. * It binds to the 3' overhang and uses its RNA template to synthesize complementary telomeric DNA repeats onto the end. * This compensates for the shortening caused by the end replication problem during cell division. * Telomerase acts in a repeating cycle, rebinding and re-extending the telomere after each round of replication. * This allows indefinite extension of the telomere, preventing it from eroding critically short. * Most somatic cells do not express telomerase, so telomeres shorten with each division eventually leading to senescence. * Telomerase is expressed in stem cells and some cancer cells, allowing them to maintain telomere length and divide indefinitely. So in summary, telomerase solves the end replication problem by using its RNA template to add back the telomeric repeats lost during replication, preventing telomere shortening.

Answer 159

Regular Cells: - Most somatic cells do not express telomerase - Telomeres shorten with each cell division due to end replication problem - Once telomeres become critically short, cells enter replicative senescence (Hayflick Limit) - This limits the replicative potential and lifespan of cells - Prevents abnormal cells from dividing indefinitely, acting as a tumor suppressor mechanism Cancer Cells: - Many cancer cells reactivate or upregulate telomerase expression - Telomerase maintains telomere length by adding back repeats after replication - This allows cancer cells to divide indefinitely without hitting replicative senescence - Circumvents the Hayflick Limit and enables unlimited replicative potential - Facilitates immortalization, a hallmark of cancer cells - Suggests telomerase inhibition could be a therapeutic target in cancer treatment So in summary: - Lack of telomerase in normal cells limits replicative potential as a protective mechanism - Telomerase reactivation in cancer cells confers unlimited replicative ability by maintaining telomeres - This key difference in telomere maintenance separates mortal normal cells from immortal cancer cells

Answer 160

- Leading strand is synthesized continuously in the 5' to 3' direction by DNA polymerase - Lagging strand is synthesized discontinuously in 5' to 3' direction as Okazaki fragments - For any given replication fork, there is one leading strand and one lagging strand template - The new leading strand is synthesized continuously from start to end - The new lagging strand starts with RNA primer and Okazaki fragment, synthesized discontinuously - When the replication fork meets the next origin, roles reverse for leading/lagging - The new strands get synthesized partially as previous leading, partially as previous lagging So in essence, all newly replicated double-stranded DNA molecules contain regions synthesized via both leading and lagging strand mechanisms at alternating sections along their length. No single new strand is purely leading or purely lagging in its synthesis.

Answer 161

1. Chromosome Size: - Eukaryotic chromosomes are much larger (millions to billions of base pairs) compared to a single bacterial circular chromosome (millions of base pairs) - More origins are required to replicate the larger eukaryotic chromosomes in a reasonable time frame 2. Linear vs Circular: - Eukaryotic chromosomes are linear - Replication can only proceed bi-directionally from each origin - More origins are needed along the length of linear chromosomes 3. Nuclear Membrane: - In eukaryotes, replication occurs in the nucleus - The nuclear membrane acts as a barrier limiting the minimum number of replication forks 4. Chromosome Compaction: - Eukaryotic chromatin is highly compacted, making it harder for replication machinery to travel long distances - Multiple closely-spaced origins help replication traverse compacted chromatin regions 5. Cell Cycle Regulation: - Eukaryotic cell cycles are more complex and strictly regulated - Multiple origins ensure coordinated and complete replication within the time constraints In contrast, the smaller circular bacterial chromosome can be replicated from a single origin more easily within their simpler cell cycle. So the larger size and linear nature of eukaryotic chromosomes necessitates having many more replication origins.

Answer 162

The origin of replication is a specific sequence of DNA where the replication of the DNA molecule begins. It serves as the starting point for the assembly of the replication machinery and the initiation of DNA synthesis during DNA replication. Each DNA molecule typically has multiple origins of replication to ensure efficient and timely replication of the entire genome.

Answer 163

A DNA replication bubble is a region of DNA where the double helix unwinds and opens up to form two single strands during DNA replication. It is characterized by the formation of a replication fork, where new DNA strands are synthesized in opposite directions. The replication bubble expands bidirectionally as DNA replication proceeds, with each replication fork moving outward from the origin of replication.

Answer 164

A single-stranded DNA binding protein (SSBP) is a protein that binds to single-stranded DNA (ssDNA) to stabilize and protect it from degradation or reannealing during DNA replication, repair, or recombination processes. SSBPs prevent the reformation of double-stranded DNA (dsDNA) and help to keep the DNA in a suitable conformation for enzymatic processing. They play crucial roles in various cellular processes, including DNA replication, DNA repair, and homologous recombination.

Answer 165

A replication fork is a structure formed during DNA replication where the double helix unwinds and separates into two single strands. It is characterized by the presence of two replication forks moving in opposite directions from the origin of replication. At each replication fork, the parental DNA strands serve as templates for the synthesis of new DNA strands, leading to the formation of two daughter DNA molecules. The replication fork is the site of active DNA synthesis and is associated with various proteins and enzymes involved in DNA replication, such as DNA polymerases, helicases, and single-stranded DNA binding proteins.

Answer 166

DNA polymerase is an enzyme responsible for synthesizing new DNA strands by catalyzing the addition of nucleotides to a growing DNA chain during DNA replication. DNA polymerases require a template strand and a primer strand to initiate DNA synthesis and extend the primer in the 5' to 3' direction. These enzymes are essential for accurate and efficient replication of the genome and play key roles in DNA repair and other DNA metabolic processes. Multiple DNA polymerases exist in cells, each with specific functions and properties.

Answer 167

Primase is an enzyme responsible for synthesizing short RNA primers on single-stranded DNA templates during DNA replication. These RNA primers provide a starting point for DNA polymerases to initiate DNA synthesis. Primase synthesizes RNA primers by catalyzing the addition of ribonucleotides to the DNA template, creating a short stretch of RNA that serves as a primer for DNA polymerase. Once the RNA primer is synthesized, DNA polymerase extends it by adding deoxyribonucleotides, ultimately forming a new DNA strand complementary to the template. Primase plays a crucial role in the initiation of DNA replication and is essential for the synthesis of both the leading and lagging strands of the replication fork.

Answer 168

Helicase is an enzyme that catalyzes the unwinding of the double-stranded DNA helix during DNA replication, transcription, and repair. It uses the energy from ATP hydrolysis to break the hydrogen bonds between the complementary base pairs, separating the two DNA strands and creating a replication fork. Helicase plays a crucial role in the initiation of DNA replication by creating the single-stranded DNA templates required for the synthesis of new DNA strands by DNA polymerases. It also participates in various other DNA metabolic processes, such as DNA repair and recombination, by facilitating the unwinding of DNA duplexes to allow access for other proteins and enzymes.

Answer 169

An RNA primer is a short segment of RNA nucleotides that serves as a starting point for DNA synthesis during DNA replication. Primers are synthesized by the enzyme primase, which adds complementary RNA nucleotides to the template DNA strand. These RNA primers provide a free 3' hydroxyl group for DNA polymerase to initiate DNA synthesis, as DNA polymerase can only elongate an existing strand and cannot initiate synthesis de novo. RNA primers are later removed and replaced with DNA nucleotides by DNA polymerase, resulting in the synthesis of a continuous DNA strand.

Answer 170

A sliding clamp, also known as a clamp loader, is a protein complex that helps to hold DNA polymerase onto the template DNA strand during DNA replication. It encircles the DNA double helix and forms a ring-shaped structure that can slide along the DNA strand. The sliding clamp acts as a processivity factor, allowing DNA polymerase to remain attached to the DNA template for extended periods and catalyze the addition of nucleotides to the growing DNA strand without dissociating. This enhances the efficiency and speed of DNA replication by preventing the polymerase from falling off the template DNA strand.

Answer 171

The leading strand is the DNA strand that is synthesized continuously in the 5' to 3' direction during DNA replication. It is synthesized in the same direction as the movement of the replication fork and requires only one RNA primer for initiation. DNA polymerase synthesizes the leading strand continuously by adding nucleotides to the 3' end of the RNA primer as the replication fork progresses. Since the leading strand is synthesized continuously, there is no need to repeatedly start and stop DNA synthesis, resulting in faster and more efficient replication compared to the lagging strand.

Answer 172

The lagging strand is the DNA strand that is synthesized discontinuously in the 5' to 3' direction during DNA replication. It is synthesized in the opposite direction to the movement of the replication fork, which necessitates the use of multiple RNA primers for initiation. DNA polymerase synthesizes short fragments of DNA, called Okazaki fragments, on the lagging strand, starting from each RNA primer and extending in the direction away from the replication fork. After synthesis, the RNA primers are removed, and the gaps between the Okazaki fragments are filled in by DNA polymerase and sealed by DNA ligase, resulting in the synthesis of a continuous DNA strand.

Answer 173

An Okazaki fragment is a short segment of DNA nucleotides synthesized discontinuously on the lagging strand during DNA replication. These fragments are typically around 100-200 nucleotides in length in prokaryotes and shorter in eukaryotes. Each Okazaki fragment is initiated by the synthesis of an RNA primer by primase, which provides a starting point for DNA polymerase to elongate the fragment. DNA polymerase then synthesizes DNA nucleotides in the 5' to 3' direction, away from the replication fork, until it encounters the RNA primer of the adjacent Okazaki fragment or reaches the end of the DNA template. After synthesis, the RNA primers are removed, and the gaps between the Okazaki fragments are filled in by DNA polymerase and sealed by DNA ligase, resulting in the synthesis of a continuous lagging strand.

Answer 174

DNA polymerase I is a type of DNA polymerase enzyme found in bacteria, including the well-studied Escherichia coli. It plays multiple roles in DNA replication, repair, and recombination. In DNA replication, DNA polymerase I is involved in removing RNA primers from Okazaki fragments on the lagging strand and replacing them with DNA nucleotides during synthesis. This process, known as primer removal and gap filling, ensures the continuity of the lagging strand. Additionally, DNA polymerase I is involved in DNA repair processes, such as base excision repair and nucleotide excision repair, where it fills in gaps left after damaged nucleotides are removed. Furthermore, DNA polymerase I also possesses 5' to 3' exonuclease activity, allowing it to proofread and correct errors in newly synthesized DNA strands. Overall, DNA polymerase I plays essential roles in maintaining the integrity and fidelity of the bacterial genome.

Answer 175

DNA ligase is an enzyme that seals nicks in DNA strands by catalyzing the formation of phosphodiester bonds between adjacent DNA fragments.

Answer 176

The Hayflick limit is the maximum number of times a human cell population can divide before it stops dividing and enters a state of senescence or cell death.

Answer 177

The end replication problem refers to the challenge of replicating the ends of linear DNA molecules, where the last RNA primer cannot be replaced with DNA nucleotides, leading to gradual shortening of the chromosome ends with each round of replication.

Answer 178

Telomeres are repetitive DNA sequences at the ends of chromosomes that protect them from degradation and fusion, and their shortening with each cell division contributes to aging.

Answer 179

Telomerase is an enzyme that adds repetitive DNA sequences to the ends of linear chromosomes, known as telomeres, to counteract their shortening during DNA replication and cellular division.

Answer 180

G1 (Gap 1) Phase: - Cells increase in mass and size - Carry out metabolic functions - Check for any DNA damage before proceeding S (Synthesis) Phase: - DNA replication occurs - Chromosomes are duplicated G2 (Gap 2) Phase: - Cell continues growing - Produces proteins for mitosis - Checks for any DNA damage before mitosis M (Mitosis) Phase: - Nuclear envelope breaks down - Chromosomes condense and are separated - Cytoplasm divides forming two daughter cells Cytokinesis: - Final physical separation of the cytoplasm - Occurs after mitosis is complete G0 (Quiescent) Phase: - Cell exits the cycle, no growth/division - Some cells enter this resting state - Can re-enter cycle under right conditions The key control checkpoints occur at the G1/S and G2/M transitions, ensuring proper replication and segregation before advancing the cycle. Proper regulation of this cycle is critical for growth and reproduction.

Answer 181

The cell cycle serves three main purposes: 1. Cell Growth and Replication: - Allows cells to replicate their DNA (S phase) and divide to produce genetically identical daughter cells (M phase) - Enables growth, repair, and replacement of cells in multicellular organisms - Facilitates asexual reproduction in unicellular organisms 2. Genetic Regulation and Integrity: - Has checkpoints (G1/S and G2/M) to ensure DNA is replicated and repaired properly before division - Prevents propagation of genetic errors or damaged DNA to daughter cells - Maintains proper ploidy levels and chromosomal organization 3. Cellular Differentiation and Development: - Cell division allows transformation of a single-celled zygote into a complete organism (embryogenesis) - Regulated cell cycles allow stem cells to differentiate into various specialized cell types - Precisely timed cycles coordinate developmental processes like morphogenesis So in summary, the three key purposes are: 1) Replicating genetic material for growth/reproduction 2) Regulating genetic fidelity and integrity 3) Enabling cellular differentiation for development Proper regulation of the cell cycle is crucial for the survival, propagation and development of all living organisms.

Answer 182

Here are the key points about cyclin-CDK complexes and how they are regulated during the cell cycle: Cyclin-CDK Complexes: - Cyclins are regulatory proteins that undergo cyclical synthesis and degradation - CDKs (Cyclin-Dependent Kinases) are serine/threonine kinase enzymes - Cyclins activate their respective CDK partners by binding to them Functions: - Cyclin-CDK complexes phosphorylate various substrate proteins - This drives progression through different cell cycle phases - Different cyclin-CDK complexes are active at specific phases Regulation: - Cyclin levels fluctuate - synthesized and degraded at specific times - This periodically activates and inactivates different CDKs - CDK activity is also regulated by activating/inhibitory phosphorylation - CDK inhibitor proteins (CKIs) can bind and inhibit CDK activity Key Complexes: - G1/S: Cyclin D-CDK4/6, Cyclin E-CDK2 (initiate DNA replication) - S: Cyclin A-CDK2 (continues DNA replication) - G2/M: Cyclin B-CDK1 (promotes mitosis entry) - M: Cyclin B-CDK1 (drives through metaphase/anaphase) So in summary, cyclical synthesis/degradation of cyclins activates specific CDK partners at the right times, driving orderly progression through cell cycle phases. Multiple regulatory mechanisms tightly control this process.

Answer 183

Here are the key points to understand how cyclin-CDK activity determines which cell cycle phase a cell is in: - Different cyclin-CDK complexes are active and regulate different phases of the cell cycle. - The specific cyclins that are present determine which CDKs are activated, as cyclins are the regulatory subunits. - In G1 phase, Cyclin D-CDK4/6 and Cyclin E-CDK2 are active, preparing the cell for DNA synthesis. - In S phase, Cyclin A-CDK2 is the active complex driving DNA replication. - In G2 phase, Cyclin A-CDK1 is active, allowing the cell to grow and prepare for mitosis. - At the G2/M transition, Cyclin B-CDK1 becomes active, triggering breakdown of the nuclear envelope. - During M phase, Cyclin B-CDK1 continues to be active, facilitating chromosome condensation and segregation. - The periodic cyclical synthesis and degradation of cyclins leads to the sequential activation of different CDKs. - This regulated cyclin oscillation creates an orderly progression through the cell cycle phases. So in essence, the specific cyclin-CDK complexes that are active act as molecular markers, determining which phase of the cycle a cell is currently in based on their substrate activities. Their precise regulation is critical for proper cell cycle progression.

Answer 184

1. Cyclical synthesis and degradation of cyclins: - Cyclins are synthesized and degraded in a specific temporal order - This allows activation of different CDK partners sequentially, not simultaneously - Prevents skipping phases or reversal of the cycle 2. Substrate specificity of cyclin-CDK complexes: - Each cyclin-CDK complex phosphorylates a distinct set of substrates - This triggers phase-specific events like DNA replication, chromosome condensation etc. - Creates a unidirectional cascade of events 3. Irreversibility of some events: - Some cyclin-CDK initiated events are irreversible once started - E.g. Breakdown of nuclear envelope in M phase - This commits the cell to completing that phase and the entire cycle 4. Checkpoints and regulation: - Checkpoints restrict transitions until prerequisites are met - CDK activity is regulated by inhibitors and activating/inactivating phosphorylation - This precise control prevents reversal or skipping of phases 5. Oscillation of cyclin levels: - Cyclin levels rise and fall in a wave-like pattern - Successive cyclin-CDK waves push the cycle in a unidirectional manner So in summary, the ordered appearance, substrate specificity and regulated activity of cyclin-CDKs, coupled with the irreversibility of some events, ensures the cell cycle follows a strict unidirectional sequence of phases without reversal or phase skipping.

Answer 185

The cell cycle is the series of events that take place in a cell leading to its division and duplication. It consists of interphase (G1, S, and G2 phases), during which the cell grows and replicates its DNA, and mitotic (M) phase, where the cell divides into two daughter cells through mitosis and cytokinesis.

Answer 186

G0 phase is a resting phase in the cell cycle where cells temporarily exit the cell cycle and enter a quiescent state. Cells in G0 are not actively dividing but may re-enter the cell cycle in response to specific signals or stimuli.

Answer 187

G1 phase is the first gap phase of the cell cycle, occurring after mitosis and before DNA synthesis (S phase). During G1 phase, the cell grows in size, synthesizes proteins, and prepares for DNA replication.

Answer 188

S phase is the synthesis phase of the cell cycle, occurring after G1 phase and before G2 phase. During S phase, DNA replication takes place, resulting in the synthesis of an identical copy of the cell's genetic material.

Answer 189

G2 phase is the second gap phase of the cell cycle, occurring after DNA synthesis (S phase) and before mitosis (M phase). During G2 phase, the cell continues to grow and prepares for cell division by synthesizing proteins and organelles needed for mitosis.

Answer 190

M phase, or mitotic phase, is the phase of the cell cycle during which cell division occurs. It consists of two main stages: mitosis and cytokinesis. Mitosis is the process by which the nucleus of the cell divides into two daughter nuclei with identical genetic material. Cytokinesis is the division of the cytoplasm, resulting in the formation of two separate daughter cells.

Answer 191

Cyclin is a family of proteins that regulate the progression of the cell cycle by activating cyclin-dependent kinases (CDKs). Cyclins bind to CDKs, forming complexes that phosphorylate target proteins and drive the transitions between different phases of the cell cycle. Cyclin levels fluctuate during the cell cycle, peaking at specific stages to coordinate cell cycle events.

Answer 192

Cyclin-dependent kinase (CDK) is an enzyme that regulates the cell cycle by phosphorylating target proteins in complex with cyclin proteins.

Answer 193

1. Global Regulatory Mechanisms: - Epigenetic modifications (DNA methylation, histone modifications) can influence gene expression across the entire genome. - Chromatin remodeling complexes can alter chromatin accessibility and structure, impacting multiple genes. - Global transcription factors and signaling pathways can coordinate the expression of gene networks. 2. Regulatory Landscapes: - The genome contains regulatory regions (promoters, enhancers, insulators) that influence the expression of nearby genes. - These regulatory elements can interact with each other and with distant genes through chromatin looping. - The organization and interaction of these regulatory elements create complex regulatory landscapes. 3. Cellular Context: - Gene regulation is highly context-dependent, varying based on cell type, developmental stage, and environmental conditions. - Each cell type has a specific gene expression profile determined by its unique combination of regulatory factors and chromatin state. 4. Systems-Level Analysis: - High-throughput techniques (ChIP-seq, RNA-seq, ATAC-seq) can map regulatory elements, chromatin states, and gene expression levels across the entire genome. - Integration and analysis of these large-scale datasets can reveal global regulatory patterns and networks. 5. Computational Approaches: - Bioinformatics tools and machine learning algorithms can identify regulatory motifs, predict regulatory interactions, and model gene regulatory networks. - Systems biology approaches can integrate diverse data types to understand the complex interplay of regulatory mechanisms. To truly understand gene regulation from a genome-wide perspective, we need to consider the interplay of global regulatory mechanisms, the organization of regulatory landscapes, the cellular context, and leverage high-throughput data and computational approaches to uncover the complex systems-level regulatory networks that govern gene expression patterns across the genome.

Answer 194

1. Cyclin-CDK regulation: - Cyclical synthesis and degradation of cyclins activate specific CDK partners at precise times - This creates an irreversible, unidirectional wave of cyclin-CDK activity driving the cycle forward - Substrate specificity of cyclin-CDKs triggers phase-specific, irreversible events like DNA replication 2. Cell cycle checkpoints: - Checkpoints act as regulatory control points between phases - They monitor completion of prerequisites (e.g. DNA replication) before allowing progression - Checkpoints are enforced by inhibiting cyclin-CDK activity until requirements are met Together, these regulatory mechanisms work in the following way: - In G1 phase, cyclin D/E-CDK complexes prepare the cell for S phase, but cannot initiate DNA replication directly. - The G1/S checkpoint ensures cyclin E-CDK2 is only activated once prerequisites (cell size, nutrients) are fulfilled. - Once activated, cyclin E-CDK2 and cyclin A-CDK2 initiate DNA replication by phosphorylating replication initiation factors. - However, their precisely timed cyclin oscillations ensure DNA replication occurs only once per cycle. - The S phase checkpoint monitors completion of replication before activating cyclin B-CDK1 for mitosis. - Cyclin B-CDK1 then triggers a cascade of irreversible events like nuclear envelope breakdown, committing to mitosis. - This unidirectional cyclin-CDK oscillation coupled with checkpoints coordinating phase transitions prevents re-replication or reversal. So in essence, the orderly activation of cyclin-CDKs drives unidirectional progression, while checkpoints ensure genome duplication occurs exactly once before division, maintaining genomic integrity.

Answer 195

1. Global Regulatory Mechanisms: - Epigenetic modifications (DNA methylation, histone modifications) can influence gene expression across the entire genome. - Chromatin remodeling complexes can alter chromatin accessibility and structure, impacting multiple genes. - Global transcription factors and signaling pathways can coordinate the expression of gene networks. 2. Regulatory Landscapes: - The genome contains regulatory regions (promoters, enhancers, insulators) that influence the expression of nearby genes. - These regulatory elements can interact with each other and with distant genes through chromatin looping. - The organization and interaction of these regulatory elements create complex regulatory landscapes. 3. Cellular Context: - Gene regulation is highly context-dependent, varying based on cell type, developmental stage, and environmental conditions. - Each cell type has a specific gene expression profile determined by its unique combination of regulatory factors and chromatin state. 4. Systems-Level Analysis: - High-throughput techniques (ChIP-seq, RNA-seq, ATAC-seq) can map regulatory elements, chromatin states, and gene expression levels across the entire genome. - Integration and analysis of these large-scale datasets can reveal global regulatory patterns and networks. 5. Computational Approaches: - Bioinformatics tools and machine learning algorithms can identify regulatory motifs, predict regulatory interactions, and model gene regulatory networks. - Systems biology approaches can integrate diverse data types to understand the complex interplay of regulatory mechanisms. To truly understand gene regulation from a genome-wide perspective, we need to consider the interplay of global regulatory mechanisms, the organization of regulatory landscapes, the cellular context, and leverage high-throughput data and computational approaches to uncover the complex systems-level regulatory networks that govern gene expression patterns across the genome.

Answer 196

Growth Factor Control of Cell Cycle Entry: - Cells require extracellular mitogenic growth factors to drive quiescent cells into the cell cycle - Growth factors bind to cell surface receptors, activating intracellular signaling pathways - These pathways lead to increased levels of G1 cyclins (Cyclin D) and CDK activation Restriction Point: - The restriction point or "start" is a key control point late in G1 phase - Before this point, the cell is sensitive to growth factor levels and can exit the cycle - After the restriction point, the cell becomes insensitive to growth factors - It is now committed to completing the current cell cycle Growth Factor Sensitivity vs Insensitivity: - In early G1, the cell is growth factor sensitive - it requires mitogenic signals to progress - If growth factors are removed before the restriction point, the cell exits the cycle back to G0 - After passing the restriction point in late G1, activation of Cyclin E-CDK2 commits the cell cycle - Now the cell cycle progresses autonomously, insensitive to growth factor levels So in summary: - Growth factors drive quiescent cells past the restriction point in G1 - This commits the cell to replicating its DNA and dividing - The restriction point separates the growth factor sensitive and insensitive periods - It acts as a crucial irreversible switchpoint controlling cell proliferation Understanding this restriction point control allows regulation of abnormal proliferative disorders.

Answer 197

1. Cyclin-CDK oscillation drives unidirectional progression: - Different cyclin-CDK complexes are activated sequentially in an oscillating pattern - This creates an irreversible, forward-driving cascade of events - E.g. Cyclin E/A-CDK2 for S phase entry, Cyclin B-CDK1 for mitosis 2. Substrate specificity and irreversible events: - Each cyclin-CDK complex phosphorylates specific substrates for that phase - Some events initiated are irreversible once started (e.g. nuclear envelope breakdown) - This commits the cell to completing that phase and the entire cycle without reversal 3. Regulated cyclin synthesis/degradation: - Cyclins have burst of synthesis followed by scheduled degradation - This ensures a cyclin-CDK is only active during its designated phase - Prevents re-replication by not allowing Cyclin E/A re-accumulation in S phase 4. DNA replication licensing and checkpoints: - Origins of replication are "licensed" only once per cycle by controlling factors - The G1/S and intra-S checkpoints verify replication has not been initiated/completed - This ensures replication is not re-initiated if blocked/stalled 5. DNA damage checkpoints: - The G2/M checkpoint prevents entry into mitosis if DNA is damaged - Gives time for DNA repair before segregating chromosomes - Halts the cycle to avoid passing on mutations to daughter cells So the precise, transient regulation of cyclin-CDKs, coupled with licensing mechanisms and checkpoints, allows one round of replication per cycle while ensuring genomic integrity by repairing damage before division. This unidirectional, irreversible system maintains ploidy.

Answer 198

Transcriptional Regulation: - Transcription factors like E2F control expression of cyclin genes in a cell cycle-dependent manner - E.g. E2F activates cyclin E/A for G1/S transition when conditions are favorable Post-Transcriptional Regulation: - Regulation of mRNA stability and localization impacts cyclin/CDK levels - E.g. Cell cycle-regulated miRNAs can destabilize cyclin mRNAs Translational Regulation: - Regulation of translation initiation/elongation affects synthesis of cyclins/CDKs - E.g. mTOR pathway mediates translation in response to growth factors Post-Translational Regulation: - Cyclin degradation, CDK inhibitor binding, CDK activating phosphorylation - Critical for coordinating cyclin-CDK oscillations and activities These multi-layered regulations work together: 1) To produce cyclins/CDKs only when extracellular conditions (growth factors/nutrients) are favorable for growth/division. 2) To generate precisely timed waves of cyclin-CDK activities that drive unidirectional, irreversible transition between phases. 3) To enforce the Restriction point in G1 - a point of no return after which the cycle proceeds autonomously. 4) To implement critical DNA damage checkpoints that halt the cycle until DNA lesions are repaired before segregating chromosomes. So transcriptional/post-transcriptional control regulates cyclin synthesis, while translation and post-translational mechanisms facilitate the periodic cyclin-CDK activities - all converging onto the core cell cycle engine in response to internal/external cues. This integrated regulatory network ensures controlled proliferation and genomic integrity.

Answer 199

The quiescent state, also known as G0 phase, is a period in the cell cycle where cells temporarily exit the cycle and remain in a non-dividing, resting state.

Answer 200

A target gene is a specific gene that is regulated by a transcription factor or other regulatory protein, resulting in changes in its expression levels or activity.

Answer 201

A growth factor is a signaling molecule that stimulates cell growth, proliferation, and differentiation by binding to specific receptors on the surface of target cells and activating intracellular signaling pathways.

Answer 202

The restriction point, also known as the R point, is a key regulatory checkpoint in the G1 phase of the cell cycle. It represents the point beyond which progression through the cell cycle becomes independent of external growth signals. Once the cell passes the restriction point, it commits to completing the cell cycle and entering S phase, regardless of subsequent changes in external conditions.

Answer 203

A growth factor-sensitive cell is one that responds to the presence of a growth factor by initiating cell proliferation, growth, or differentiation. In contrast, a growth factor-insensitive cell does not respond to the same growth factor stimulus and remains quiescent or exhibits limited growth and proliferation.

Answer 204

Stages of Cancer: 1) Initiation - First mutagenic event leads to transformation of a normal cell to a tumor cell. 2) Promotion - Tumor cells with activated oncogenes/inactivated tumor suppressors start proliferating. 3) Progression - Additional mutations accumulate, tumor becomes invasive and metastatic. Hallmarks of Cancer (Acquired Capabilities): 1) Sustained Proliferative Signaling - Cancer cells produce their own growth signals. 2) Evading Growth Suppressors - Defective pathways that normally inhibit cell proliferation. 3) Resisting Cell Death - Evading apoptosis pathways allows survival and accumulation of mutations. 4) Enabling Replicative Immortality - Upregulating telomerase to escape Hayflick limit. 5) Inducing Angiogenesis - Promoting growth of new blood vessels to supply nutrients. 6) Activating Invasion and Metastasis - Ability to invade local tissue and spread to distant sites. 7) Reprogramming Energy Metabolism - Preferentially using glycolysis (Warburg effect). 8) Evading Immune Destruction - Avoiding immune surveillance and destruction. 9) Genome Instability - Enabling mutational capability via defective DNA repair mechanisms. 10) Tumor-Promoting Inflammation - Inflamed tumor microenvironment supports other hallmarks. These acquired capabilities, driven by genetic/epigenetic changes, allow cancer cells to survive, proliferate, and disseminate - the essence of the neoplastic disease process.

Answer 205

Proto-oncogene: - A normal cellular gene that codes for proteins involved in regulation of cell growth and differentiation - When mutated or overexpressed, it has the potential to become an oncogene that can cause cancer Oncogene: - A gene that has undergone mutation or dysregulation, causing a gain-of-function - Oncogene products (proteins) allow uncontrolled cell growth and division - Oncogenes are derived from proto-oncogenes by mutation or increased expression - Examples: RAS, MYC, HER2/neu Tumor Suppressor Gene: - A gene that codes for proteins that inhibit cell division, repair DNA mistakes, or induce apoptosis - Mutation or inactivation (loss-of-function) of these genes allows uncontrolled proliferation - Both copies must be inactivated to fully disable tumor suppressor function ("two-hit" hypothesis) - Examples: TP53, RB1, BRCA1/2, APC In summary: - Proto-oncogenes are normal genes that can be converted to oncogenes by mutation - Oncogenes promote cell growth and division in an unregulated manner - Tumor suppressor genes normally act as brakes on cell division and survival - Inactivation of tumor suppressors removes these brakes, enabling cancer development The interplay between activated oncogenes and inactivated tumor suppressors disrupts the normal regulation of the cell cycle and drives the uncontrolled proliferation characteristic of cancer.

Answer 206

1) UV-Induced Thymidine Dimers: - UV radiation from sunlight causes covalent linkages between adjacent thymines - Forms cyclobutane pyrimidine dimers or 6-4 photoproducts - Distorts the DNA helix and blocks replication/transcription 2) Replication Stress: - Stalled or collapsed replication forks during DNA replication - Can be caused by DNA lesions, depleted nucleotide pools, or tightly bound proteins - Leads to exposure of single-stranded DNA vulnerable to breakage 3) Double-Strand Breaks (DSBs): - Both strands of DNA helix are severed - Highly cytotoxic if unrepaired - Caused by ionizing radiation, reactive oxidants, replication errors 4) Chromosomal Rearrangements: - Translocations: Swapping of genetic material between non-homologous chromosomes - Inversions: Reversing the orientation of a chromosomal segment - Deletions: Loss of a chromosomal segment These chromosome abnormalities result from misrepair of DSBs or replication errors and can lead to: - Loss of genomic material - Gene fusions - Dysregulation of gene expression - Genomic instability promoting cancer Proper DNA repair mechanisms like nucleotide excision repair, mismatch repair, homologous recombination, and non-homologous end joining are critical for maintaining genomic integrity by fixing these diverse DNA lesions.

Answer 207

1) Sensing DNA Damage: - Sensor proteins detect specific types of DNA lesions (e.g. ATR for ssDNA, ATM for DSBs) - This initiates a signal transduction cascade 2) Activating DDR Kinases: - Sensor proteins activate downstream transducer kinases like ATR, ATM, CHK1, CHK2 - These phosphorylate numerous substrate proteins to amplify the damage signal 3) DNA Damage Checkpoints: - Key substrates are checkpoint proteins that induce cell cycle arrest - Allow time for DNA repair before proceeding with replication/division 4) Cell Cycle Arrest: - Checkpoints activate cell cycle inhibitors that inactivate cyclin-CDK complexes - G1/S checkpoint prevents initiation of DNA replication - Intra-S checkpoint stalls ongoing replication - G2/M checkpoint prevents entry into mitosis 5) DNA Repair Pathways: - Various repair mechanisms are activated in parallel (e.g. NER, MMR, HR, NHEJ) - Repair proteins are recruited to damage sites by DDR proteins 6) Cell Fate Decision: - If damage is repaired, checkpoints are deactivated and cell cycle restarts - If damage is excessive/irreparable, apoptosis or senescence pathways are induced So in summary, the DDR senses the DNA lesion, activates checkpoints to arrest the cell cycle, allows repair pathways to fix the damage, and then either restarts the cycle or triggers cell death - preventing propagation of mutations to daughter cells.

Answer 208

Preventing Mutations and Genomic Instability: - The DDR detects and repairs various types of DNA lesions before they become mutations - This prevents accumulation of oncogenic mutations in genes like proto-oncogenes and tumor suppressors - It also fixes DNA breaks and errors that can lead to chromosomal abnormalities Averting Mutator Phenotype: - The mutator phenotype refers to a high spontaneous mutation rate in cancer cells - It is often caused by defects in DNA repair pathways like mismatch repair (MMR) - An intact DDR helps maintain low baseline mutation rates by repairing mistakes Enforcing Cell Cycle Checkpoints: - The DDR triggers cell cycle checkpoints to halt progression in presence of DNA damage - This provides time for repair and prevents replication or segregation of damaged DNA - Failure of these checkpoints leads to propagation of mutations Inducing Apoptosis or Senescence: - If the damage burden is too high, the DDR can induce apoptosis or senescence - This eliminates severely mutated cells that could potentially become cancerous - It prevents proliferation of genomically unstable cells By coordinately detecting, signaling and promoting repair of DNA lesions, while eliminating heavily damaged cells, the DDR acts as a critical anti-cancer barrier. Defects in DDR pathways are observed in many cancer types and promote tumorigenesis through genomic instability.

Answer 209

A tissue border refers to the boundary between adjacent tissues or regions within an organism. It delineates the spatial separation between different types of tissues, such as epithelial and connective tissues, or between different functional regions within an organ. Tissue borders play important roles in maintaining tissue organization, function, and integrity, as well as regulating cellular interactions and signaling between adjacent tissues.

Answer 210

A benign tumor is a mass of cells that grows slowly and remains localized without invading surrounding tissues or spreading to distant sites in the body. Unlike malignant tumors (cancer), benign tumors are typically well-defined, non-invasive, and do not metastasize to other parts of the body. While benign tumors are not cancerous, they can still cause health problems depending on their size, location, and effects on nearby tissues or organs.

Answer 211

A malignant tumor, or cancer, is a mass of abnormal cells that grow uncontrollably, invade surrounding tissues, and can spread to other parts of the body through metastasis.

Answer 212

Cancer is a disease characterized by the uncontrolled growth and spread of abnormal cells in the body.

Answer 213

Invasive refers to the ability of cells, tissues, or tumors to penetrate and spread into surrounding tissues or organs.

Answer 214

Metastasis, or metastatic cancer, refers to the spread of cancer cells from the primary tumor to distant sites in the body, where they form secondary tumors.

Answer 215

An oncogene is a gene that has the potential to cause cancer when mutated or overexpressed. These genes typically encode proteins involved in cell growth, proliferation, or survival, and their abnormal activation can drive uncontrolled cell growth and contribute to the development of cancer.

Answer 216

A tumor suppressor is a gene that encodes a protein involved in inhibiting cell growth, proliferation, or survival. These proteins help regulate the cell cycle, repair damaged DNA, and promote programmed cell death (apoptosis), thereby preventing the development of cancer. Loss or inactivation of tumor suppressor genes can lead to uncontrolled cell growth and contribute to the formation of tumors.

Answer 217

A nucleotide crosslink, specifically a T-T crosslink, refers to a covalent bond formed between two adjacent thymine (T) bases on the same DNA strand due to exposure to certain environmental agents, such as ultraviolet (UV) radiation. These crosslinks can distort the DNA structure and interfere with DNA replication and transcription, potentially leading to mutations or DNA damage if not repaired properly.

Answer 218

Apoptosis is a programmed cell death process that occurs in multicellular organisms as a mechanism to remove unwanted or damaged cells.

Answer 219

DNA damage checkpoints, including the G1/S, S phase, and G2/M checkpoints, are regulatory mechanisms in the cell cycle that monitor the integrity of the DNA and prevent the progression of cell cycle stages if DNA damage is detected.

Answer 220

A mutator phenotype refers to a condition in which cells have an increased rate of mutation compared to normal cells, resulting from defects in DNA repair mechanisms or other factors that promote genomic instability.

Answer 221

1. For a given chromosomal rearrangement involving different genes: - I will consider the normal functions of those genes and how their dysregulation could contribute to hallmarks of cancer - For example, if the rearrangement creates a fusion oncogene by joining two proto-oncogenes, it could lead to uncontrolled proliferative signaling - Or if it deletes/truncates a tumor suppressor gene, it removes that critical brake on cell division/survival 2. I understand that the consequences of some mutations/rearrangements may be cell type-specific due to differential gene regulation: - Some genes are only expressed/required in certain cell types based on the cell's transcriptional program - Their regulatory regions like enhancers/promoters may also be cell type-specific - So a rearrangement disrupting regulatory elements would impact gene expression differently across cell types - This could explain why some cancers originate from and are limited to a particular cell lineage Additionally, I'll consider how the genetic lesion may alter chromatin topology/organization and impact regulatory landscapes genome-wide in that cell type. The complex interplay between DNA sequence changes and transcriptional regulatory programs determines the ultimate oncogenic outcome.

Answer 222

G1/S Checkpoint Activation: - In G1, sensor proteins like the MRN complex detect DSBs and activate the kinase ATR - ATR phosphorylates and activates the effector kinase CHK1 - Active CHK1 inhibits CDC25A phosphatase that normally removes inhibitory phosphorylations on cyclin-CDK complexes - This prevents activation of cyclin E/A-CDK2, blocking initiation of DNA replication - CHK1 also activates the transcription factor p53, which induces p21 (CDK inhibitor) - p21 inhibits cyclin E/A-CDK2, reinforcing the G1/S cell cycle arrest In parallel: - ATR and CHK1 activate repair proteins like BRCA1 to initiate DNA repair pathways - They also induce expression of genes involved in nucleotide metabolism, dNTP production G2/M Checkpoint Activation: - In G2, DSBs are sensed by ATM and the MRN complex - Activated ATM/ATR phosphorylate CHK1/CHK2 effector kinases - CHK1/2 inhibit CDC25C, preventing its removal of inhibitory phosphates on cyclin B-CDK1 - This maintains cyclin B-CDK1 in an inactive state, preventing entry into mitosis - p53 is also activated, inducing proteins like 14-3-3 sigma that sequesters cyclin B-CDK1 Simultaneously: - ATM/ATR activate DNA repair pathways like homologous recombination and non-homologous end joining - Cell cycle arrest allows time for repair before segregating damaged chromosomes So in summary, upon DSB detection, the DDR activates specific transcriptional programs and post-translational mechanisms to inhibit cyclin-CDK activities, induce cell cycle checkpoints, and simultaneously activate DNA repair pathways - an integrative response ensuring genomic integrity is maintained.

Answer 223

For any given scenario, I will: 1) Identify the specific gene(s)/protein(s) impacted and their normal roles in cell cycle control or DNA repair pathways. 2) Classify whether the gene is typically an oncogene or tumor suppressor based on its function: - Oncogenes: Promote cell proliferation/survival when mutated/overactive - Tumor suppressors: Inhibit cell division/induce apoptosis when mutated/inactivated 3) Determine if the scenario represents: - An activating mutation in an oncogene - An inactivating mutation/loss in a tumor suppressor 4) Explain the downstream consequences by reasoning how that genetic change would disrupt normal regulation: - For oncogene mutation: Uncontrolled proliferative signaling, evading growth suppression, etc. - For tumor suppressor mutation: Inability to induce cell cycle arrest, apoptosis resistance, etc. 5) Discuss how the specific defect enables hallmark capabilities of cancer like sustained proliferation, evading cell death, genomic instability, etc. 6) For cell cycle/DDR mutations, analyze how the regulatory Circuit is rewired, like: - Inability to activate checkpoints - Failure to inhibit cyclin-CDK activities - Impaired DNA repair pathways

Answer 224

Positive Feedback Loop: - In a positive feedback loop, the initial change/stimulus leads to a response that further amplifies or reinforces the original stimulus. - This causes an increasing, self-perpetuating cycle that continues until some limiting factor intervenes. - Example: Blood clotting process - clotting factors activate enzymes that produce more clotting factors, amplifying the clotting cascade. How to recognize: - The response or output of the loop acts to increase/intensify the original input signal - Creates a cyclical, amplifying effect that accelerates a particular direction/outcome - Often requires an external brake or limitation to terminate the self-amplifying cycle Negative Feedback Loop: - In a negative feedback loop, the initial change/stimulus elicits a response that counteracts or negates the original stimulus. - This creates a self-correcting cycle that opposes and reverses any deviation from the desired set-point. - Example: Regulation of blood glucose levels - high glucose triggers insulin release which acts to lower glucose levels. How to recognize: - The output or response reduces/opposes the original input stimulus - Creates a cyclical, dampening effect that stabilizes a particular parameter around a set value - Promotes equilibrium and homeostasis by reversing deviations in either direction So in summary: - Positive loops amplify and reinforce changes in one direction until limited - Negative loops counteract changes to maintain constant values/states - Analyzing whether the cycle output enhances or diminishes the initial stimulus reveals the loop type

Answer 225

1) There are many proteins that work with ribosome that can be regulated and promote/inhibit translation initiation and elongation IMPORTANT! Codon usage is not something cells actively change! This comes from genome evolution! tRNA abundance b/c they are transcribed can be regulated like gene expression.

Answer 226

1. Phosphorylation - add phosphate to serine, threonine, or tyrosine aa 2. Acetylation – add acetyl to lysine aa 3. Methylation – add methyl to lysine aa 4. Glycosylation – add sugar to aa 5. Ubiquitination – add of ubiquitin (small protein) to lysine aa 6. Palmitoylation - Add fatty acid cysteine aa Enzymes add | remove Kinase | phosphatase AcTransferase | deacetylase MeTransferase | demethylase don’t care Ub Ligase | Deubiquitinating Enz don’t care

Answer 227

Covalently No Yes

Answer 228

Transcription (all at initiation) - chromatin accessibility of the gene *euk only (though bac do have ”chromatin”) - DNA methylation *both - activators, repressors, silencers, enhancers, operators *both Post-transcriptional - alternative splicing of mRNA *euk only - mRNA modification *both - but polyA and 5’cap are *euk only -5’ and 3’ UTR regulation *both - small nc-RNAs binding to UTRs *both but siRNA only euk

Answer 229

RNA polymerases do not need primers RNA polymerase is like an enzyme w/TWO hands – each can grab a free nucleotide and bring them together. Can start a strand from scratch DNA polymerases need an RNA primer Primer is a short strand of complementary RNA or DNA. It provides an existing 3’OH for DNA polymerase to add to DNA polymerase is like an enzyme w/ONE hand – can only grab one free nucleotide and add to existing strand

Answer 230

Purpose – melt the dsDNA at origin to produce a replication bubble that contains specific proteins needed for replication elongation

Answer 231

G1 phase – cell grows S phase – Synthesis: DNA replication G2 phase – cell grows more & prepares for mitosis Mitosis – division of duplicated chromosomes Cytokinesis – division of cytoplasm G0 – cell has exited cell cycle and not dividing

Answer 232

Purpose – replicate DNA by synthesizing complementary bases to the template (parent) strand

Answer 233

UV damage causes covalent crosslinks between two adjacent thymidines Thymidine dimers cause a kink in helix and block DNA polymerases but not helicases

Answer 234

1) Ensures replicate genome once and only once. 1a Cell Cycle occurs in one direction only – no reversing! 1b Once the decision to divide is made cells cannot exit the cell cycle until complete 2) Separate replicated genome into two nuclei (mitosis) 3) No DNA damage or unwanted changes to the genome passed on

Answer 235

* Cyclin-dependent kinases (CDK) phosphorylate cell cycle proteins to allow cells to progress through the cell cycle * Cyclin – protein regulatory subunit of cyclin-dependent kinases (CDK) required for CDK activity

Answer 236

proto-oncogene – a gene whose normal function promotes cell division or survival oncogene – mutant form of a proto- oncogene that causes too much cell division or inappropriate survival tumor suppressor – a genes whose normal function is to inhibit cell division, induce cell death when necessary, or repair DNA damage

Answer 237

Cyclin-CDK of previous phase controls activity of next phase’s cyclin and ensures proceed in one direction only – each cyclin-CDK regulates the activity of the next cyclin. – cannot control the cyclin for the previous phase – Ensures cell cycle proceeds in one direction

Answer 238

Replication Stress – any type of damage or alteration that causes the excessive ssDNA formation due to DNA polymerase blockage

Answer 239

1. Chromosomal Translocations: - DSBs on two different chromosomes can be incorrectly joined by error-prone non-homologous end joining (NHEJ) repair - This creates an abnormal fusion chromosome, known as a translocation - Translocations can lead to formation of chimeric fusion genes with dysregulated function - Example: BCR-ABL fusion in chronic myeloid leukemia is an oncogenic translocation 2. Inversions and Deletions: - A single DSB that is mis-rejoined can cause inversion of the DNA sequence orientation - Or if the broken ends fail to rejoin, it results in a chromosomal deletion - Both events can remove or disrupt coding regions, regulatory elements like enhancers/promoters - Loss of critical genes like tumor suppressors facilitates cancer development 3. Gene Dysregulation: - Chromosomal rearrangements can also reposition genes near different regulatory regions - This can abnormally activate proto-oncogenes or silence tumor suppressor genes - Example: Deletion of CDKN2A locus deregulates cell cycle inhibitors in many cancers 4. Genomic Instability: - Improper DSB repair also generates vulnerabilities for further breakage events - This genomic instability fuels acquisition of compounding mutations - The "mutator phenotype" is a hallmark enabling other cancer hallmarks So in summary, the major consequence of mis-repaired DSBs is the generation of chromosomal abnormalities that deregulate gene expression, disrupt critical genes, produce fusion oncogenes, and enable genomic instability - all of which are driver events in cancer initiation and progression.

Answer 240

Gamma irradiation, X-rays – causes DNA double strand breaks; the phosphate sugar backbone is broken on both strands. One of most harmful types of DNA damage bc large pieces of genome can be lost or rearranged

Answer 241

mutator phenotype: increased rate of mutations and survival of cells with mutations

Answer 242

1. **Proteins sense DNA damage:** Specialized proteins detect DNA damage within the cell. 2. **ATM, ATR, and DNA-PK kinases:** These are enzymes that play key roles in the DNA damage response. They activate various cellular responses when DNA damage is detected. 3. **DNA damage checkpoints:** Upon sensing DNA damage, the cell cycle can be arrested at specific checkpoints to allow time for repair before cell division proceeds. 4. **Repair the damage:** Various mechanisms exist within the cell to repair DNA damage, such as base excision repair, nucleotide excision repair, and homologous recombination. 5. **Apoptosis:** If the damage is too severe and cannot be repaired, the cell may undergo programmed cell death, or apoptosis, to prevent the propagation of damaged DNA.

Answer 243

In addition to “pausing” the cell cycle, DNA Damage Response activate repair mechanisms to fix damage and/or kill the cell if too much damage occurs

Answer 244

Damage checkpoints will arrest the cell cycle by inhibiting cyclin-CDK so DNA can be repaired. Once repaired, the cell cycle will resume. If damage is too extensive cell will initiate programmed cell death – apoptosis. This is the last cell cycle purpose

Answer 245

protective cap/ buffer that can be lost before genes are lost.

Answer 246

1. Telomerase has a repetitive RNA template complementary to telomeres 2. Telomerase possesses DNA pol activity The RNA template bound to telomerase serves TWO functions: a) brings telomerase only to telomeres bc the RNA template can only bp with telomere sequence b) serves as the template for telomerase to synthesize telomere repeat

Answer 247

1. Telomerase is a reverse transcriptase that adds telomeric repeats to chromosome ends. Its expression allows unlimited replicative potential. 2. In normal somatic cells that should divide only a limited number of times (Hayflick limit), telomerase expression is tightly repressed. 3. Promoters with high CG density can be regulated by DNA methylation - a repressive epigenetic mark. Putting this together: In a normal somatic cell undergoing senescence, the telomerase promoter would likely be heavily methylated to keep its expression turned off. This methylation prevents the cell from activating telomerase and becoming immortal. Conversely, in a cancer cell with high telomerase expression (a hallmark of most cancers), the telomerase promoter would be unmethylated or hypomethylated. This lack of repressive methylation, combined with activating mutations in the promoter and/or transcriptional machinery, allows for aberrant upregulation of telomerase in cancer cells. The unmethylated, active state of the telomerase promoter in cancer enables telomere maintenance and unlimited replicative potential - one of the key acquisitions that permits unconstrained proliferation of the malignant cells. So in summary, proper methylation-mediated silencing of the telomerase promoter enforces the mortality of normal cells, while its hypomethylation in cancers contributes to the immortality and uncontrolled growth of these cells by permitting telomerase expression.

Answer 248

Restriction Point is the threshold of S cyclin concentration that commits the cell to enter and complete the cell cycle. EVEN IF conditions change and nutrients are not available the cell will continue to progress after the restriction point. Before the restriction point cells are growth factor sensitive but after the restriction point cells are growth factor insensitive

Answer 249

activators and repressors

Answer 250

PTMs used to enact post-translational regulation varies among cyclin-CDK. Localization varies as well: cytoànucleus vs nucleus à cyto vs. cyto<--> nucleus Do not memorize. Understand

Answer 251

Growth factors activate a kinase that phosphorylates the transcription factor c-myc. Phosphorylated c-myc can bind to its regulatory element When growth factor is absent, a phosphatase is active that dephosphorylates c-myc. c-myc can NOT bind to its regulatory element

Answer 252

Damage checkpoints will arrest the cell cycle by inhibiting cyclin-CDK so DNA can be repaired. Once repaired, the cell cycle will resume. If damage is too extensive cell will initiate programmed cell death – apoptosis. This is the last cell cycle purpose

Answer 253

A must be inhibited

Answer 254

only one origin in bacteria while 100s-1000s of origins in eukaryotes

Answer 255

An siRNA is binding to the mRNA's UTR.

Answer 256

one scientist includes alternative splicing

Answer 257

histone acetylation

Answer 258

Inhibit a repressor of G1 cyclin transcription

Answer 259

double-stranded DNA breaks

Answer 260

3’ tactagtggtttttggcgttggacgtgagcggg 5’ template strand 5’ atgatcaccaaaaaccgcaacctgcactcgccc 3’ coding strand 5’ augaucaccaaaaaccgcaaccugcacucgccc 3’ mRNA transcript

Answer 261

False. Sigma factor needed, and it is a general TF

Answer 262

F, need to be explored from nucleus, spliced, and modified

Answer 263

F, can be one gene controlled by one promoter

Answer 264

F, first part true, but more non-coding than coding in euk

Answer 265

F, RNAP synthesizes 5’ to 3’. Since it must make a strand complementary to its template, the template must be 3’ to 5’ b/c strands of nucleic acids are always anti-parallel

Answer 266

F, bind double- stranded DNA in major or minor grooves.

Answer 267

F, they have histone-like proteins and are compacted

Answer 268

Acetylated histones causes chromatin to loosen (or to be converted to euchromatin) and be more accessible by TFs. This allows genes to be transcribed. Without the histone acetylase, chromatin could not be remodeled to euchromatin and might remain methylated or heterochromatinized. This would prevent TFs from being able to bind and keep genes off during development that need to be on.

Answer 269

heavily methylated

Answer 270

parental strands are reunited in the conservative model but remain with newly synthesized daughter strands in the semiconservative model

Answer 271

the leading strand requires a single RNA primer, and the lagging strand requires multiple priming events

Answer 272

Gaps left at the 5' end of the lagging strand

Exam 2 Flashcards

(381 cards)