Exam 2 (Lect. Qs 11-15) Flashcards
(198 cards)
1
Q
A bacterium that can use NO3- as a terminal electron acceptor is found to obtain sulfur granules. This cell . . .
A. reduces sulfur
B. oxidizes NO3-
C. is a nitrifying bacterium
D. is a chemotroph
E. cannot produce a PMF directly
A
is a chemotroph
2
Q
At the molecular level, how is a proton gradient generated by the quinone loop?
A. Light causes the quinone to “flip” a proton to the outside of the membrane
B. The quinone donates 2 protons to to O2 to make water, which leaves the cell
C. The quinone donates both H+ and electrons, but FeS proteins only accept electrons
D. The quinone, which is located in periplasm, accepted H+ from the cytoplasm
E. Electrons in the quinone are excited by light, and end up in NADH, which creates the PMF
A
The quinone donates both H+ and electrons, but FeS proteins only accept electrons
3
Q
Compared to mitochondrial ETS (electron transport systems), bacterial ETS . . .
A. use far fewer quinones
B. use a much greater variety of terminal electron acceptors
C. do not have cytochromes
D. always generate much less of a PMF
E. typically involve 6 electron transport components rather than 5
A
use a much greater variety of terminal electron acceptors
4
Q
In oxygenic photosynthesis, as practiced in bacteria . . .
A. the electrons that are excited by light return to the same photosystem
B. the main photosynthetic reaction pigment is bacteriochlorophyll
C. the electrons have such low energy that they must be energized twice
D. oxygen is the terminal electron acceptor
E. there are two electron transport chains
A
there are two electron transport chains
5
Q
Why are purple sulfur bacteria considered metabolically unique?
A. They use H2S as an electron donor.
B. They must perform reverse electron transport to make NADH.
C. They use only one photosynthetic reaction center.
D. They produce a PMF from photosynthetic electron transport.
E. They make oxygen as a byproduct of photosynthesis.
A
They must perform reverse electron transport to make NADH.
6
Q
How are respiratory and photosynthetic electron transport chains similar?
A. Both use the same electron donor.
B. Both use the same terminal electron acceptor.
C. Both use heme-containing electron carriers.
D. Both are used to generate reducing power for the cell.
E. Both involve adding external energy to electrons.
A
Both use heme-containing electron carriers.
7
Q
A lithotrophic bacterium can use only CO2 as a terminal electron acceptor. It might also . . .
A. be a methanogen
B. oxidize iron as an electron donor
C. contain sulfur granules
D. use glucose as both a carbon and electron source
E. reduce NH4+
A
be a methanogen
8
Q
Purple sulfur bacteria (PSB) must use reverse electron transport, but green sulfur bacteria (GSB) do not. Why is there a difference?
A. GSB use noncyclic photosynthesis, whereas PSB use cyclically.
B. PSB do not make a PMF with their electron transport chain.
C. GSB use a bacteriochlorophyll with enough energy to donate its electrons directly to ferredoxin.
D. GSB use two photosystems, thereby boosting electrons to higher energy levels.
E. Making the sulfur granules in PSB requires electrons from reverse electron transport
A
GSB use a bacteriochlorophyll with enough energy to donate its electrons directly to ferredoxin.
9
Q
Which of the following is true for all electron carriers?
A. They must be capable of being oxidized and reduced.
B. They must be able to accept both H+ and electrons.
C. They must be able to accept O2.
D. They are proteins with metal ions at the center.
E. In bacteria, they are only found in the cytoplasm
A
They must be capable of being oxidized and reduced.
10
Q
During oxygenic photosynthesis, the terminal electron acceptor for the electron transport chain involving photosystem II and plastoquinone is . . .
A. oxygen
B. NADP+
C. the reaction center of photosystem I
D. H2O
E. ATP
A
the reaction center of photosystem I
11
Q
Which of the following is similar in all three photosynthetic mechanisms we discussed?
A. the way reducing power is formed
B. the use of water as an electron donor
C. the photosynthetic reaction center chlorophyll
D. the way ATP is formed
E. the electrons return to the reaction center from which they were oxidized
A
the way ATP is formed
12
Q
Which of the following statements correctly describes the molecule at right?
A. it can only be reduced, not oxidized
B. it carries only electrons, not H+
C. it carries only H+, not electrons
D. it carries both electrons and H+
E. it carries electrons from glycolysis to the TCA cycle
A
it carries only electrons, not H+
13
Q
Which of the following is true of the mitochondrial electron transport system in eukaryotes, but NOT always true of bacterial electron transport systems?
A. cytochrome c oxidase is always the final electron transport complex
B. several terminal electron acceptors can be used simultaneously
C. the number of H+ pumped can vary depending on the needs of the cell
D. a quinone loop is used to couple electron transport to proton pumping
E. the initial electron donor is the oxidized form of NAD+
A
cytochrome c oxidase is always the final electron transport complex
14
Q
According to the diagram at the right, NH4+ could serve as the electron donor for . . .
A. organisms that use SO4 as the terminal electron acceptor
B. obligate aerobes
C. fermentation
D. organisms that reduce CO2 to CH4
E. sulfur oxidizing bacteria
A
obligate aerobes
15
Q
Some photosynthetic bacteria need to generate reducing power by reverse electron transport because . . .
A. their electron donor has too few electrons to reduce NAD
B. their photosystems are inverted in the membrane
C. they use plant-type chlorophyll instead of bacteriochlorophyll
D. they perform only cyclic photosynthesis
E. their photosynthetic electron acceptor lacks the energy to donate electrons to NADP
A
their photosynthetic electron acceptor lacks the energy to donate electrons to NADP
16
Q
Why do most photosynthetic bacteria produce a complex containing antenna pigments?
A. it allows them to use multiple electron acceptors in their electron transport chains
B. the antenna complex oxidizes water to O2 for use in respiration
C. it allows them to channel additional photons of light to the reaction center
D. electrons from the antenna complex can be used to produce additional ATP
E. it allows them to increase the energy level of the photosynthetic reaction center
A
it allows them to channel additional photons of light to the reaction center
17
Q
During a reaction in the electron transport chain, an electron acceptor . . .
A. must also accept H+
B. must have more energy than the electron donor
C. must be a protein
D. must be able to synthesize ATP
E. must be reduced by the electron donor
A
must be reduced by the electron donor
18
Q
In an electron transport chain, proteins 1 and 2 (P1 and P2) are structured as shown in the diagram. Which of the following most accurately describes the roles of these proteins?
A. P1 contributes H+ to the PMF, but P2 does not.
B. P2 contributes H+ to the PMF, but P1 does not.
C. Both P1 and P2 contribute H+ to the PMF.
D. P1 produces the PMF that P2 turns into ATP.
E. P2 produces the PMF that P1 turns into ATP
A
P1 contributes H+ to the PMF, but P2 does not.
19
Q
Which of the following correctly describes the direct mechanism of chemiosmotic ATP synthesis?
A. An ATP Synthase accepts electrons to reduce ADP to ATP.
B. Energy from a H+ gradient turns a rotor to push ADP and ~P together.
C. An enzyme attaches H+ from the PMF to ADP to make ATP.
D. Energy released by hydrolysis is coupled by a rotary enzyme to the phosphorylation of ADP.
E. Due to membrane semi-permeability, ATP can enter the cell, but ADP cannot.
A
Energy from a H+ gradient turns a rotor to push ADP and ~P together.
20
Q
The following electron transport chain . . .
NADH -> Nitrates reductase complex -> Nitrate -> Ammonia
A. is an example of a fermentation pathway
B. cannot make a PMF
C. is an example of substrate-level phosphorylation
D. is a type of respiration
E. probably came from a mitochondrion
A
is a type of respiration
21
Q
The goal of reverse electron transport, as carried out by purple photosynthetic bacteria, is to . . .
A. make ATP
B. make NADH
C. make O2
D. return electrons to Photosystem 2
E. use energy from alternate wavelengths of light
A
make NADH
22
Q
Why is it important that some electron carriers carry both electrons and protons, while others carry only electrons?
A. This is how the Q loop pumps protons across a membrane.
B. This is necessary for energy to be given from one molecule to another in redox reactions.
C. The carriers that are proteins carry both H+ and electrons.
D. The ones that carry only electrons provide energy for cellular rotary motors.
E. For antiports to function, protons must go one way and electrons the other.
A
This is how the Q loop pumps protons across a membrane.
23
Q
A microbiologist examining an environmental sample hypothesizes that a newly discovered bacterial lithotroph donates redox electrons from Fe+2, using SO4-2 as a terminal electron acceptor. Is this hypothetical energy generation scheme possible?
A. No, because SO4-2 is already reduced.
B. No, because this transfer does not release energy.
C. Yes, it is quite likely.
D. Yes, but there may be no enzymes with active sites for both Fe+2 and SO4-2.
E. Yes, as long as the bacterium is growing aerobically.
A
No, because this transfer does not release energy.
24
Q
Which of the following statements most accurately compares how ATP is generated during cyclic versus non-cyclic photosynthesis (PS)?
A. Reverse electron transport must be used to synthesize ATP during cyclic PS.
B. In non-cyclic PS, electrons from H2O are used to reduce ADP to ATP in Photosystem II.
C. ATP is made by oxidation during non-cyclic PS, but by reduction during cyclic PS.
D. There is no ATP made during cyclic PS, but there is during non-cyclic PS
E. ATP is produced by the same mechanism during cyclic PS as it is during non-cylic PS
A
ATP is produced by the same mechanism during cyclic PS as it is during non-cylic PS
25
When comparing green sulfur and purple sulfur bacteria . . .
A. green sulfur bacteria generate O2; purple sulfur bacteria do not
B. green sulfur bacteria use chlorophyll; purple sulfur use bacteriochlorophyll
C. purple sulfur bacteria have a lower energy photosystem than green sulfur bacteria do
D. purple sulfur bacteria do not accumulate sulfur granules; green sulfur bacteria do
E. purple sulfur bacteria produce a form of hemoglobin to bind O2.
purple sulfur bacteria have a lower energy photosystem than green sulfur bacteria do
26
The outline of oxygenic photosynthesis is shown, with electron transfer steps marked 1 through 5. Which step is responsible for generation of reducing power?
A. electron transfer #1
B. when electrons are excited as at #2
C. electron transfer #3
D. when electrons are excited as at #4
E. electron transfer #5
electron transfer #5
27
The use of an organic electron acceptor without producing a PMF from the electron transfer is known as . . .
A. heterotrophy
B. fermentation
C. anaerobic respiration
D. organotrophy
E. This is never done. Electron transfer always produces a PMF
fermentation
28
Based on the table of electron reducing potentials at the right, electron transfer between which of the following donors and acceptors could yield the MOST energy?
A. aerobic respiration using FADH2 as the electron donor
B. electron transfer from Ferredoxin to NADP+
C. Complex I, which transfers electrons from NADH to Ubiquinone
D. Iron-reducing lithotrophy with H2 as the electron donor
E. Autotrophy with NH4+ as the electron donor
Iron-reducing lithotrophy with H2 as the electron donor
29
How does electron transport lead to the formation of a proton gradient?
A. A special rotary motor pumps out H+ as electrons cause it to turn in the membrane.
B. A symport mechanism uses the membrane potential to transport electrons out of the cell along with H+.
C. Electrons reduce H2O to O2, and the 2 H+ are released to the outside of the cell by diffusion.
D. An antiport mechanism pushes H+ out as it takes electrons in
E. One member of the transport chain is reduced by both H+ and electrons, but only the electrons are passed to the next member
One member of the transport chain is reduced by both H+ and electrons, but only the electrons are passed to the next member
30
What is meant by oxidative phosphorylation?
A. Oxidation of ADP to ATP
B. Oxidation of ATP to ADP
C. Production of ATP during glycolysis or the TCA cycle
D. Production of ATP from the PMF using ATP Synthase
E. ANY transfer of phosphate during a redox reaction
Production of ATP from the PMF using ATP Synthase
31
Why is non-cyclic photosynthesis also called "oxygenic" photosynthesis?
A. The electron acceptor for PSI is O2.
B. O2 is produced during the electron transfer from PSI to PSII.
C. The electron donor for PSII is H2O.
D. It uses the same respiratory chain as mitochondria, but in reverse.
E. It is usually an anaerobic process
The electron donor for PSII is H2O.
32
Compare oxygenic photosynthetic (OPS) and respiratory (RES) electron transport chains.
A. OPS use chlorophyll in the places where RES use cytochromes
B. OPS uses reverse electron transport to make ATP, but RES uses the ATP Synthase
C. OPS does not produce a PMF, but RES does
D. They both use oxygen as the terminal electron acceptor, but use different donors
E. they both use quinones and cytochromes in a Q-loop to produce a PMF
they both use quinones and cytochromes in a Q-loop to produce a PMF
33
The chemical DCCD binds irreversibly to the proton binding site of the FOF1 ATP Synthase. What is the most likely consequence if DCCD is added to a culture of a facultative anaerobe?
A. The cells will die because they can't produce ATP.
B. The flagellar rotation speed would briefly increase due to a larger PMF.
C. The ATP Synthase would rotate passively, but wouldn't produce ATP.
D. The cell would produce much less of a PMF.
E. The cell would be OK, since the H+ binding site is not the place where ATP is made
The flagellar rotation speed would briefly increase due to a larger PMF.
34
How does oxidative phosphorylation make ATP?
A. It oxidizes ADP to make ATP
B. It oxidizes glucose to make CO2
C. It oxidizes NAD to make NADH
D. It oxidizes electron carriers to make a PMF
E. It oxidizes oxygen to produce water
It oxidizes electron carriers to make a PMF
35
When asked to sketch the reaction scheme for green sulfur photosynthetic bacteria on an exam one year, a student presented the diagram at right. I tried to find something he got correct to give him some credit. What did he get correct?
A. The use of two photosystems
B. The way ATP is produced from electrons
C. The way NADPH is produced directly
D. The production of O2 from PSII
E. Nothing – he got a zero on this one
The way NADPH is produced directly
36
We believe that the evolution of photosynthesis progressed from purple to green to cyanobacterial types. From the human point of view, the development of oxygenic photosynthesis was the most important advance in this progression. But what was the most important advance from the bacteria's point of view (i.e. what gave them the greatest evolutionary advantage)?
A. The ability to produce a photosynthetic PMF
B. The evolution of light acceptors that could accept lower wavelengths of light
C. The ability to make ATP from a photosynthetic electron transport chain
D. The ability to use water as an electron acceptor rather than H2S
E. Still the production of O2, since O2 was necessary for a respiratory chain to evolve
The evolution of light acceptors that could accept lower wavelengths of light
37
A major difference between quinones and hemes in the electron transport chain is that . . .
A. quinones can only be oxidized; hemes only reduced
B. quinones accept and donate both H+ and electrons; hemes only electrons
C. quinones are produced in the TCA cycle; hemes come from glycolysis
D. quinones have a lower energy level than hemes do
E. quinones are a terminal electron acceptor; hemes an initial electron donor
quinones accept and donate both H+ and electrons; hemes only electrons
38
Which of the following is NOT important in a bacterial electron transport chain when creating a PMF?
A. Having oxygen as the terminal electron acceptor
B. Having electron acceptors with lower energy than the donors
C. Passing electrons between carriers near the periplasmic side of the membrane
D. Redox energy being used to open proton transport channels
E. The membrane being impermeable to charged ions
Having oxygen as the terminal electron acceptor
39
How could you best determine whether an unknown respiratory chain was from a bacterium or from a eukaryotic mitochondrion?
A. Whether it used NADH as an electron donor or not
B. Whether it produced ATP directly or indirectly
C. Whether a different magnitude of PMF can be produced under different conditions
D. Whether cytochrome c were an electron acceptor or not
E. Whether it involved a quinone loop or not
Whether a different magnitude of PMF can be produced under different conditions
40
Which of the following best describes how ATP is produced by oxidative phosphorylation?
A. The PMF reduces NADH to ATP
B. The PMF adds a proton to ADP to make ATP
C. electrons from the transport chain turn a rotor to make ATP
D. electrons from the transport chain reduce ADP to ATP
E. The PMF turns a rotor which pushes ADP and phosphate together
The PMF turns a rotor which pushes ADP and phosphate together
41
You notice a “rotten egg” smell coming from the black goo in the iron drain pipe in your kitchen. You could get rid of the smell by adding which of the following?
A. Sulfate reducers
B. Purple sulfur bacteria
C. Methanogenic bacteria
D. Clostridial spores
E. Sulfur oxidizing bacteria
sulfur oxidizing bacteria
42
Nitrifying bacteria cause a high biological oxygen demand (BOD) in a pond . . .
A. when NH4+ is present, since they metabolize it with O2 as the electron acceptor.
B. when NO2- is present, since O2 is required to reduce it.
C. whenever they are present, since they have a high growth rate.
D. when lots of organic matter is present, since they are organotrophs.
E. only when they are fixing nitrogen
when NH4+ is present, since they metabolize it with O2 as the electron acceptor.
43
Rhizobium produces leghemoglobin . . .
A. as part of its electron transport chain
B. as an iron-rich nutrient
C. to allow it to carry out photosynthesis
D. to bind O2 in order to protect nitrogenase
E. as a dormant resting stage instead of endospores
to bind O2 in order to protect nitrogenase
44
Which of the following uses mainly fats and oils as carbon sources, producing acids and CO2 by fermentation?
A. Rhizobium
B. Clostridium
C. Propionibacterium
D. Pseudomonas
E. Caulobacter
Propionibacterium
45
If you see the following structure on a plant, you could conclude that . . .
A. The plant is producing food for a bacterium
B. A bacterium is fixing nitrogen for the plant
C. The plant is infected with a fungus
D. A bacterium on the plant is reducing sulfate
E. The respiration rate inside the structure is elevated, and [O2] is reduced
The plant is producing food for a bacterium
46
This bacterium lives in packets of four cells, two of which have their DNA tightly surrounded by a protein ring that protects it against extreme levels of radiation.
A. Pseudomonas
B. Myxobacterium
C. Bdellovibrio
D. Deinococcus
E. Streptomyces
Deinococcus
47
You live near a swamp, and notice the “rotten egg” smell of H2S. Having taken micro, you decide to bacterially remediate the odor. Which of the following bacterial types would NOT be able to do the job if added to the swamp?
A. Green sulfur bacteria
B. Sulfate reducing bacteria
C. Chemolithoautotrophs
D. Sulfur oxidizing bacteria
E. Photolithoautotrophs
Sulfate reducing bacteria
48
What bacteria carry out the reaction marked "A" in the
nitrogen cycle?
A. Nitrate oxidizing bacteria
B. Nitrate reducing bacteria
C. Nitrogen fixing bacteria
D. Nitrifying bacteria
E. Denitrifying bacteria
Denitrifying bacteria
49
Because it has a large number of modular catabolic pathways that produce intermediates that feed into glycolysis, this bacterium can catabolize almost anything. It is often used to break down environmental pollutants in the process of bioremediation.
A. Pseudomonas
B. Rhizobium
C. Agrobacterium
D. Propionibacterium
E. Deinococcus
Pseudomonas
50
Agrobacterium tumifaciens is especially important to plant scientists. What is so special about it?
A. It makes a carbon source that plants can use to grow.
B. It fixes nitrogen in plant root nodules.
C. It forms cysts that help to aerate the soil.
D. It can be used to insert foreign DNA into plant cells.
E. It is an excellent bacterial model for the plant type of photosynthesis
It can be used to insert foreign DNA into plant cells.
51
This bacterium produces CO2 and acids from growth on fats and oils, such as are present on your skin in hair follicles.
A. Propionibacterium
B. Pseudomonas
C. Rhizobium
D. Pyruvobacter
E. Deinococcus
Propionibacterium
52
You're an engineer working on a bridge repair project. You notice that the buried iron bridge supports are coated in black, smelly ooze. What could you conclude is present in the soil?
A. Sulfate
B. Oxygen
C. Leghemoglobin
D. Nitrate
E. Sulfuric acid
Sulfate
53
The free-living nitrogen fixing bacterium Azotobacter has a much higher rate of cellular respiration than other bacteria. Why?
A. It has a much larger need for ATP than other bacteria
B. Its respiratory chain is less efficient than usual, since it doesn't donate electrons to O2
C. To protect the enzyme nitrogenase from oxygen
D. It gives much of its energy to a parasitic symbiont
E. It needs oxygen in large amounts for the metabolically active cysts
To protect the enzyme nitrogenase from oxygen
54
The bacterium Agrobacterium tumifaciens is very important in plant biology. Why?
A. It causes economic damage to corn and soybeans.
B. It can form endospores, which can adhere to the underside of leaves.
C. It passes back and forth between plant cells, carrying communication molecules.
D. It inserts a plasmid into plant cells, and can therefore be used in genetic engineering.
E. It associates with the roots of legumes, "fixing" nitrogen in a form plants can use
It inserts a plasmid into plant cells, and can therefore be used in genetic engineering.
55
This bacterium has well defined stalked and flagellated poles, which interchange in alternate generations of its life cycle, as shown.
A. Bdellovibrio
B. Caulobacter
C. Myxobacterium
D. Photobacterium
E. Streptomyces
Caulobacter
56
Sulfate reducing bacteria . . .
A. produce sulfide, which forms a black precipitate on buried iron surfaces
B. produce H2SO4, and are therefore often acidophiles
C. are all obligate aerobes
D. are frequently also methanogens
E. are a subcategory of the larger group known as "purple sulfur bacteria
produce sulfide, which forms a black precipitate on buried iron surfaces
57
Which of the following bacteria carry out fermentations important to the food industry in the production of dairy products and sauerkraut?
A. Clostridium
B. Deinococcus
C. Lactic Acid Bacteria
D. Bdellovibrio
E. Myxobacteria
Lactic Acid Bacteria
58
Which of the following would be the most appropriate term to put in the box marked "????" at right?
A. N2
B. denitrification
C. nitrogen fixation
D. nitrification
E. nitrate reduction
nitrification
59
What problem do all nitrogen fixing bacteria have in common?
A. They are aerobes, but nitrogenase is damaged by oxygen.
B. They must somehow get into plant root cells without being detected.
C. They must be able to carry out photosynthesis underground in the soil.
D. They need a very broad metabolic capacity to survive in a nutrient-poor environment.
E. They experience a lot of DNA damage, and so need highly efficient repair systems.
They are aerobes, but nitrogenase is damaged by oxygen.
60
Sulfur oxidizing bacteria . . .
A. produce sulfide, which forms a black precipitate on buried iron surfaces
B. are frequently also methanogens
C. produce H2SO4, and are therefore often acidophiles
D. usually grow anaerobically, using sulfur as an electron acceptor
E. are a subcategory of the larger group known as "green sulfur bacteria
produce H2SO4, and are therefore often acidophiles
61
In the diagram of the Nitrogen cycle at the right, which of the following bacteria could carry out the indicated step?
A. Agrobacterium
B. Azotobacter
C. Deinococcus
D. Nitrifying bacteria
E. Denitrifying bacteria
Azotobacter
62
Which of the following are famous for their ability to sense the presence of other bacteria, secrete slime trails and aggregate together by social gliding motility into large, complex, spore-producing structures called "fruiting bodies."
A. Caulobacter
B. Bdellovibrio
C. Corynebacterium
D. Picrophilus
E. Myxobacterium
Myxobacterium
63
Some bacteria contain a large piece of circular DNA called the Ti plasmid. What is the purpose of this plasmid?
A. to protect nitrogenase from the toxic effects of oxygen
B. to form symbiotic root nodules for nitrogen fixation
C. to increase the number of replication origins so that DNA replication is faster
D. to make an infected plant produce nutrients for the bacterium
E. to form cysts that allow the bacteria to survive harsh environmental conditions
to make an infected plant produce nutrients for the bacterium
64
The bacterium Caulobacter crescentus is well known for its ability to . . .
A. survive massive doses of radiation
B. produce light in response to cell density
C. produce endospores to survive starvation
D. grow in concentrated salt solutions
E. distinguish one end of its cell (stalk) from the other (flagella)
distinguish one end of its cell (stalk) from the other (flagella)
65
Which of the following is an accurate comparison between sulfate reducing bacteria (SRB) and sulfur oxidizing bacteria (SOB)?
A. SRB are aerobic; SOB are anaerobic.
B. SRB are lithotrophs; SOB are organotrophs.
C. SRB are phototrophs; SOB are chemotrophs.
D. SRB are generally undesirable; SOB can be used in biomining of sulfide ores.
E. SRB and SOB are closely related, and carry out very similar energy-generating reactions
SRB are generally undesirable; SOB can be used in biomining of sulfide ores.
66
Important industrial production of acetone, butanol and other organic solvents depends on . . .
A. Clostridial fermentation
B. fermentation of lipids
C. methanogenesis
D. the versatile metabolism of Pseudomonas
E. lactic acid fermentation
Clostridial fermentation
67
To check the quality of an agricultural soil you sometimes pull up certain plants and look for pink lumpy structures on the roots. What do these structures indicate?
A. the plant has been infected by a tumor-forming bacterium
B. the soil is rich in a form of nitrogen that plants can use
C. the soil is contaminated by a fungus
D. the soil is rich in oxygen because of bacteria with a high BOD
E. there are cysts of certain bacteria in the soil near the plant
the soil is rich in a form of nitrogen that plants can use
68
Which of the following reactions is carried out by methanogenic Archaea?
A. CO2 is reduced to CH4 using electrons from H2
B. CO2 is reduced to CH4 using electrons from light
C. CH4 is oxidized to CO2 using an organic electron donor
D. CH4 is oxidized to CO2 using electrons from light
E. glucose is hydrolyzed to CO2 using energy from CH4
CO2 is reduced to CH4 using electrons from H2
69
Which of the following is true about Sulfate Reducing Bacteria?
A. They produce H2SO4 that makes their environment very acidic.
B. They are used in sewage treatment to remove ammonia waste.
C. Their presence in anaerobic soil is indicated by a "rotten egg" odor.
D. They use O2 as the terminal electron acceptor of an electron transport chain.
E. They use bacteriochlorophyll for photosynthetic energy generation
Their presence in anaerobic soil is indicated by a "rotten egg" odor.
70
Which of the following bacteria both carry out fermentation reactions that are used in the preparation of important food products?
A. Clostridium and Corynebacterium
B. Caulobacter and Bacillus
C. Leuconostoc and Deinococcus
D. Lactococcus and Propionibacterium
E. Streptomyces and Pseudomonas
Lactococcus and Propionibacterium
71
You notice that one part of a plant is covered with small pinkish spherical structures, as shown in the picture at right. What can you conclude?
A. The soil in which the plant is growing must be anaerobic.
B. The spherical structures contain the enzyme nitrogenase.
C. The plant has been colonized by Azotobacter.
D. The plant has been infected by a tumor virus.
E. The nitrification process is being carried out in the spherical structures
The spherical structures contain the enzyme nitrogenase.
72
Purple nonsulfur bacteria can grow both aerobially and anaerobically, but they use different biochemical mechanisms to do so. How do these bacteria obtain reducing power when they are growing anaerobically?
A. by using electrons from light to reduce NAD+
B. mainly by using redox reactions in the TCA cycle
C. from sulfur granules that are present in the environment around the bacteria
D. by using a photosynthetic PMF to reverse a part of the electron transport chain
E. by using a rotary enzyme in the cell membrane to turn the PMF into reducing power
by using a photosynthetic PMF to reverse a part of the electron transport chain
73
Which of the following are typically lithotrophs?
A. Sulfate Reducing Bacteria
B. Lactic Acid Bacteria
C. Propionibacteria
D. Pseudomonas
E. Nitrifying Bacteria
Nitrifying Bacteria
74
How does Clostridial ABE fermentation differ from the lactic acid fermentation performed by many other bacteria?
A. ABE fermentation can ferment lipids.
B. ABE fermentation reduces NAD, rather than oxidizing NADH.
C. ABE fermentation can produce some additional ATP.
D. ABE fermentation produces methane.
E. ABE fermentation is aerobic, but most other fermentation is anaerobic
ABE fermentation can produce some additional ATP.
75
Deinococcus bacteria can be found uniquely in what environment?
A. Very low pH
B. Very high temperatures
C. Very high salt concentrations
D. Very high radiation levels
E. Very low nutrient levels
Very high radiation levels
76
What bacteria would you expect to find in dense, pink or red clusters associated with plants?
A. Rhizobium
B. Streptomyces
C. Azotobacter
D. Denitrifying bacteria
E. Photobacterium
Rhizobium
77
What is Agrobacterium noted for?
A. Cultivation of fungal symbionts
B. Natural insertion of DNA into plant cells
C. Release of digestive enzymes in response to quorum sensing
D. Reduction of O2 concentration to allow nitrogenase to function
E. Invasion of the periplasm of other Gram negative bacteria
Natural insertion of DNA into plant cells
78
You are a soil scientist trying to bioremediate (use bacteria to clean up) an area of soil contaminated by a pesticide. Which of the following bacteria would be your best choice to do this, and why?
A. Pseudomonas, because it is adaptable to growth on many different carbon sources
B. Deinococcus, because it can survive in the presence of toxins
C. Clostridium, because it can use the energy in the pesticide to fix nitrogen
D. Corynebacterium, because it produces spores which can survive in soil
E. A methanogenic Archaea, because it can grow both aerobically and anaerobically
Pseudomonas, because it is adaptable to growth on many different carbon sources
79
Myxobacteria are noted best for their . . .
A. ability to survive at low pH
B. ability to produce light when crowded together
C. ability to fix nitrogen in the soil
D. ability to aggregate in response to quorum sensing
E. ability to produce many of the useful antibiotics
ability to aggregate in response to quorum sensing
80
Which of the following has a unique cell cycle, in which only one of the two daughter cells is able to replicate directly?
A. Deinococcus
B. Bdellovibrio
C. Caulobacter
D. Picrophilus
E. Streptomyces
Caulobacter
81
Instruments that are considered medically “critical” must be
A. sanitized
B. disinfected with a high level disinfectant
C. autoclaved
D. detoxified with an antitoxin
E. sterilized
sterilized
82
Place the following organisms in order from HARDEST to kill to EASIEST.
(1) naked viruses
(2) Pseudomonas cells
(3) Bacillus endospores
(4) Giardia cysts
A. HARDEST (1) > (3) > (2) > (4) EASIEST
B. HARDEST (3) > (4) > (1) > (2) EASIEST
C. HARDEST (3) > (1) > (2) > (4) EASIEST
D. HARDEST (4) > (3) > (1) > (2) EASIEST
E. HARDEST (1) > (4) > (2) > (3) EASIEST
HARDEST (3) > (4) > (1) > (2) EASIEST
83
Which of the following methods would be acceptable to sterilize a chicken thigh that is intended for long-term storage and eventual consumption (i.e. as part of a military ration)?
A. Dry heat
B. UV-irradiation
C. microwave irradiation
D. gamma ray irradiation
E. heating to 72oC for 15 seconds
gamma ray irradiation
84
A mouthwash called “Hexodent” lists the following ingredients: 8% alcohol, 0.2% chlorhexidine, mint flavor. How does this mouthwash kill bacteria?
A. The chlorhexidine dissolves cell membranes.
B. The chlorhexidine oxidizes proteins.
C. The alcohol denatures proteins.
D. The alcohol damages DNA.
E. Chlorhexidine + ethyl alcohol → ethylene oxide, which oxidizes DNA
The chlorhexidine dissolves cell membranes.
85
Using chlorox, it takes 20 minutes to decontaminate a water bottle with 104 Cryptosporidium cysts in it. The decimal reduction time for this procedure is 10 minutes. Using the same method, how long would it take to decontaminate the water bottle if it had 108 Cryptosporidium cysts?
A. 20 minutes
B. 40 minutes
C. 60 minutes
D. 80 minutes
E. There is not enough information to answer this question
60 minutes
86
What is the difference between high-level and low-level disinfectants?
A. High-level can kill Mycobacterium, low level often cannot
B. High-level are used on countertops, low-level on floors
C. High-level are used more as skin disinfectants; low-level for metal surfaces
D. Low-level can only kill spores, high-level can also kill growing cells
E. Low-level include things like ethylene oxide and formaldehyde
High-level can kill Mycobacterium, low level often cannot
87
Rank the following treatments in terms of numbers of organisms that can survive the procedure:
1: autoclave
2: high temperature, short time (HTST) pasteurization
3: boiling
4: microwaving (not in water)
A. MOST SURVIVORS (3) > (2) > (4) > (1) LEAST SURVIVORS
B. MOST SURVIVORS (4) > (2) > (3) > (1) LEAST SURVIVORS
C. MOST SURVIVORS (4) > (3) > (2) > (1) LEAST SURVIVORS
D. MOST SURVIVORS (1) > (4) > (3) > (2) LEAST SURVIVORS
E. MOST SURVIVORS (4) > (1) > (3) > (2) LEAST SURVIVORS
MOST SURVIVORS (4) > (2) > (3) > (1) LEAST SURVIVORS
88
Why are naked viruses more resistant to disinfection than enveloped viruses are?
A. Naked viruses have a tough outer layer that resists chemical treatment
B. Enveloped viruses require at least some water for the envelope to remain intact
C. Naked viruses have a more robust metabolism, and are harder to kill
D. Enveloped viruses have transport channels that allow disinfectants into the virus
E. They aren’t. It is enveloped viruses that are more resistant to disinfectants.
Enveloped viruses require at least some water for the envelope to remain intact
89
How does UV light kill bacterial cells?
A. By cross-linking and rigidifying proteins
B. By damaging the cell membrane
C. By oxidizing cell macromolecules
D. By causing the cells to vibrate rapidly enough to shake them apart
E. By mutating the DNA
By mutating the DNA
90
Pasteurized milk . . .
A. contains no bacteria
B. has been heated briefly to 100oC
C. has been autoclaved
D. contains no endospores
E. can still have dozens of bacteria per ml
can still have dozens of bacteria per ml
91
The decimal reduction time for disinfecting a Staphylococcus-contaminated steel countertop with 500 ppm chlorine bleach is 2 minutes. Which of the following would decrease the decimal reduction time?
A. using 5000 ppm chlorine bleach rather than 500 ppm
B. disinfecting a rough surface such as a sieve or screen instead of smooth steel
C. disinfecting a greasy surface such as a dish drain instead of a countertop
D. disinfecting a surface contaminated with mycobacteria rather than Staphylococcus
E. using 70% ethanol rather than chlorine bleach
using 5000 ppm chlorine bleach rather than 500 ppm
92
Iodine and its water-soluble derivative, betadine, are commonly used disinfectants. How do they kill cells?
A. Damage DNA
B. Cross-link and rigidify proteins
C. Dissolve cell membranes
D. Dry out the cells by evaporation
E. Oxidize and denature proteins
Oxidize and denature proteins
93
Why is hydrogen peroxide (H2O2) considered high-level if used as a disinfectant, but only low-level if used as an antiseptic?
A. Skin contains catalase, which can make H2O2 less effective.
B. Antiseptics require a more rigorous definition of “sterile” than disinfectants.
C. Antiseptics are used to kill more resistant organisms than disinfectants.
D. H2O2 evaporates readily from inanimate surfaces, drying the surface more quickly.
E. H2O2 is toxic when used on skin, and thus can only be used on inanimate surfaces
Skin contains catalase, which can make H2O2 less effective.
94
Which of the following is the best method for sterilizing an implanted cardiac pacemaker?
A. Microwave it
B. Soak it in ethyl alcohol overnight
C. Wash it with a quaternary ammonium compound (QUAT)
D. Irradiate it with gamma () rays
E. A pacemaker is a semi-critical instrument and only needs to be clean, not sterile
Irradiate it with gamma () rays
95
Which of the following medical instruments is NOT matched properly with an antimicrobial method that could be used to cleanse it?
A. Surgical sponge - Quaternary ammonium salt (QUAT)
B. Central venous (in vein) catheter - Ethylene oxide
C. Gastric (stomach) endoscope - Hydrogen peroxide
D. Tracheal (lung) endoscope - Glutaraldehyde
E. Examination table - Phenolic (e.g. Lysol)
Surgical sponge - Quaternary ammonium salt (QUAT)
96
Triclosan and Lysol both kill cells by damaging cell membranes. Bacterial resistance to Lysol is unknown, but triclosan resistance has become a major medical problem. Why the difference?
A. Lysol also oxidizes proteins, so it is harder for bacteria to develop resistance.
B. Triclosan acts against a single enzyme, mutations in which allow resistance.
C. Lysol is a high-level disinfectant, triclosan only an intermediate-level one.
D. Triclosan damages the outer membrane, where resistance can develop more easily. Lysol damages the inner membrane.
E. Triclosan has been used for a longer time than Lysol. Given time, bacteria will develop Lysol resistance, too
Triclosan acts against a single enzyme, mutations in which allow resistance.
97
HTST pasteurization reduces bacterial contamination of milk by 5 logs in 15 seconds. What is the decimal reduction time for this procedure?
A. 1 second
B. 3 seconds
C. 15 seconds
D. 75 seconds
E. there is insufficient information to answer the question
3 seconds
98
A HEPA filter is used to filter the air in a hospital room. Filtered air is most likely to still contain . . .
A. Endospores
B. Mycobacterium
C. Gram positive bacteria
D. Naked viruses
E. Pseudomonas
Naked viruses
99
The most practical way to decontaminate a semi-critical medical device made of soft plastic is to . .
A. autoclave it
B. wash it with a quaternary amine (QUAT) soap
C. wash it with betadine
D. soak it in 70% ethanol
E. soak it in 3% peroxide
soak it in 70% ethanol
100
Which of the following is the most likely to be decontaminated by exposure to ethylene oxide?
A. a scalpel
B. the fluid in an IV (intravenous) drip bottle
C. a pacemaker
D. the operating room after a surgical procedure is completed
E. skin that is being prepared for surgery
a pacemaker
101
You are cleaning a food preparation surface with a disinfectant. Which of the following is the hardest to kill, and why?
A. Enveloped viruses, because the tough envelope protects them from chemical damage
B. Naked viruses, because they have no sensitive external structures
C. Mycoplasma, because they are protected by a tough, waxy outer layer
D. Gram positive cells, because they have a very thick layer of protective peptidoglycan
E. Pseudomonas, beacuse a dense protein coat protects it from chemicals, UV light, and heat
Naked viruses, because they have no sensitive external structures
102
Compared to a dry surface, an oily surface . . .
A. is likely to require a longer decimal reduction time for disinfection
B. will be more susceptible to dry heat than to steam
C. will probably require cleaning with antiseptics rather than with disinfectants
D. is easier to pasteurize but harder to sterilize
E. should have about the same properties as far as disinfection is concerned
is likely to require a longer decimal reduction time for disinfection
103
Why can UV radiation be used to kill bacteria, but microwaves cannot?
A. Microwaves only sterilize a surface; they do not penetrate.
B. Microwaves heat only bacterial proteins, not membrane lipids.
C. Microwaves do not have enough energy to damage DNA.
D. Microwave wavelength is too short to interact with things as small as bacteria.
E. Microwaves CAN be used – they just have to be used for a longer time.
Microwaves do not have enough energy to damage DNA.
104
____________ is a low-level antiseptic that damages bacterial membranes. It is often used in mouthwashes and skin care products.
A. Glutaraldehyde
B. Betadine
C. Chlorhexidine
D. Ethylene oxide
E. Formalin
Chlorhexidine
105
___________ are high-level disinfectants when used in the food industry, but only work at intermediate level when used medically on human skin.
A. Peroxides
B. Phenolics
C. Quaternary ammonium salts (QUATs)
D. Alcohols
E. Biguanides
Peroxides
106
A patient has broken his leg. He needs to have a hollow metal pin and screws inserted to stabilize the fracture. How should the pin and screws be treated prior to the surgery?
A. with a quaternary ammonium detergent
B. by boiling them
C. by irradiation with UV light
D. by soaking them in chlorine bleach
E. by autoclaving them
by autoclaving them
107
Which of the following would be the most effective disinfectant against naked viruses?
A. Formaldehyde
B. 70% Alcohol
C. Lysol (a Phenolic)
D. Chlorhexidine
E. Microwave irradiation
Formaldehyde
108
Which of the following combinations of organism and antimicrobial method has the LONGEST decmial reduction time (D)?
A. naked viruses and Lysol
B. endospores and autoclaving
C. enveloped viruses and 70% alcohol
D. Pseudomonas and UV light
E. naked viruses and formaldehyde
naked viruses and Lysol
109
As applied in a medical setting, which of the following correctly describes a critical instrument?
A. It includes anything that touches a patient's bare skin.
B. It must be rigorously decontaminated with soap and warm water.
C. High-level disinfectants must be used to clean it.
D. It could be used after treatment in an ethylene oxide chamber.
E. It must be immersed in boiling water before it can be used
It could be used after treatment in an ethylene oxide chamber.
110
By what mode of action do quaternary ammonium salts (QUATs) kill bacteria?
A. They alter protein disulfide bonding.
B. They damage the DNA backbone, causing mutations.
C. They oxidize proteins and lipids.
D. They denature proteins by interfering with hydrogen bond formation.
E. They are detergents that dissolve lipid membranes
They are detergents that dissolve lipid membranes
111
It takes 25 minutes to pasteurize milk at 65oC, which is about the temperature of your hot water at home. You just made pudding with a wooden spoon, and you want to decontaminate the spoon before you use it again. The decimal reduction time for dairy bacteria on the spoon in hot water would be about . . .
A. 2 minutes
B. 5 minutes
C. 8 minutes
D. 25 minutes
E. 30 minutes
5 minutes
112
Quaternary amines (QUATs) are low level disinfectants; aldehydes are high level. Why?
A. QUATs target proteins; aldehydes target DNA.
B. QUATs kill only naked viruses; aldehydes also kill enveloped viruses.
C. QUATs are used to disinfect floors; aldehydes are used on bench tops.
D. QUATs do not kill Mycobacteria; aldehydes do.
E. QUATs are used on critical instruments; aldehydes on both critical and semicritica
QUATs do not kill Mycobacteria; aldehydes do.
113
You're working for a company that makes I.V. solutions for use in hospitals. A particular solution contains some ingredients that are not stable at high temperatures. You are preparing the I.V. solution, putting it in airtight bags, and then sterilizing it. How would you sterilize it?
A. Place the I.V. bags under UV light
B. Expose the I.V. bags to ethylene oxide
C. Filter the I.V. solution before putting it into sterile bags
D. Add glutaraldehyde to the I.V. solution before filing the bags
E. Expose the I.V. bags to X-ray radiation
Expose the I.V. bags to X-ray radiation
114
HTST pasteurization takes 15 seconds, whereas killing 99% of bacteria at 63oC requires 12 minutes. How does the decimal reduction time compare at 72oC versus at 63oC?
A. D is > 100 times longer at 63o
B. D is > 100 times longer at 72o
C. D is between 10 and 100 times longer at 63o
D. D is between 10 and 100 times longer at 72o
E. D is approximately equal at the two temperature
D is > 100 times longer at 63o
115
A Lysol advertisement says that the product "is used in hospitals - Is the highest level disinfectant available. Kills 99.9% of germs on hard, nonporous surfaces in 30 seconds." Evaluate this claim.
A. It's honest. These are the most difficult surfaces to clean.
B. It's probably honest, but they couldn't really tell if it was 99.9%.
C. It's stretching things a bit. This would not be acceptable for any surface in a hospital.
D. It's a misstatement. 99.9% of germs in 30 seconds is actually a low level disinfectant.
E. It's a lie. Nothing could kill that many germs that fast
It's a misstatement. 99.9% of germs in 30 seconds is actually a low level disinfectant.
116
A certain depth filter is designed to remove particles larger than 5 m from air. How could you modify this filter to make it filter out bacteria?
A. Make it with smaller holes
B. Make it deeper, with more layers
C. Soak it in water before use
D. It's OK already. Bacteria are larger than this.
E. You can't filter bacteria out of the air
Make it with smaller holes
117
Which of the following is a characteristic of ionizing radiation?
A. It is only for surface sterilization
B. It includes IR, UV and microwave radiation
C. It kills cells by causing DNA mutations
D. It cannot penetrate the endospore coat
E. It includes any radiation with wavelength > 300 nm
It kills cells by causing DNA mutations
118
How would you treat an implantable cardiac defibrillator before installing it in a patient?
A. Autoclave it
B. Wash it in 70% alcohol
C. Disinfect it with a quaternary amine
D. Sterilize it with iodine
E. sterilize it with ethylene oxide
sterilize it with ethylene oxide
119
We said in class that 500 ppm bleach is used for typical disinfection. But in the food industry, the standard for washing dishes is 200 ppm to avoid chlorine in food. Which of the following statements is INCORRECT?
A. This concentration is OK, since it is used along with amphipathic detergents.
B. The effectiveness is enhanced by washing dishes in hot water.
C. It's OK, but on a smooth steel countertop it will have a longer D than 500 ppm will.
D. 200 ppm is actually better for decontaminating greasy dishes than 500 ppm.
E. Neither 200 ppm nor 500 ppm is sufficient for killing spores and cysts
200 ppm is actually better for decontaminating greasy dishes than 500 ppm.
120
Why must the lagging strand at a replication fork be replicated in short fragments?
A. DNA is always replicated in short fragments.
B. The slower replication requires DNA polymerase to start at several different places.
C. It is being replicated 3’ to 5’, which is backwards and slower than 5’ to 3’.
D. It is replicated toward the origin, but the fork is opening away from the origin.
E. There are several DNA polymerase molecules on the lagging strand
It is replicated toward the origin, but the fork is opening away from the origin.
121
Which enzyme relieves the tension in DNA caused by unwinding the helix to replicate it?
A. DNA polymerase
B. DNA gyrase
C. DNA ligase
D. DNA transcriptase
E. Okazaki enzyme
DNA gyrase
122
Which of the following is needed to replicate DNA, but is NOT needed to make RNA from DNA?
A. nucleoside triphosphates
B. a primer
C. a template
D. an enzyme
E. a free 5’ OH
a primer
123
How does a prokaryotic RNA polymerase recognize a promoter?
A. It binds to a Shine-Dalgarno sequence
B. It binds to the 5’ end of the DNA
C. It recognizes a “start” codon
D. It binds to a sequence called an “origin of replication”
E. Its sigma subunit binds to consensus sequences at -10 and -35
Its sigma subunit binds to consensus sequences at -10 and -35
124
The following segment of double stranded DNA is transcribed using the sigma factor 70, which recognizes as a consensus “TTGACA” at -35 and “TATAAT” at -10.
Which strand is the template, and in which direction is it read?
A. Top strand, read to the right.
B. Bottom strand, read to the right.
C. Top strand, read to the left.
D. Bottom strand, read to the left.
E. Either strand could be the template, read to the right.
Bottom strand, read to the right.
125
DNA polymerase CANNOT do which of the following?
A. Synthesize Okazaki fragments.
B. Move on the leading strand in the same direction as helicase.
C. Move 3’ to 5’ on the template strand for more than one base.
D. Synthesize the lagging strand continuously.
E. Hydrolyze a phosphodiester bond
Synthesize the lagging strand continuously
126
Which of the following is NOT a part of the updated (modern) “Central Dogma” of Biology?
A. DNA makes RNA
B. DNA makes DNA
C. RNA makes DNA
D. RNA makes protein
E. Protein makes RNA
Protein makes RNA
127
RED HIGHLIGHTED
A Shine Dalgarno sequence for translation serves the same function as a ________ for transcription.
A. Promoter
B. Sigma Factor
C. RNA polymerase
D. Terminator
E. Start codon
Promoter
128
The following is a depiction of double stranded DNA. The transcribed region of gene abc is indicated by the box. The bottom strand is the template. Which letter(s) could represent the location of the promoter?
A. X or Z
B. Y or Z
C. Y only
D. W or Y
E. Z only
X or Z
129
The consensus sequences for sigma 70 and sigma 28 are indicated below. If sigma 28 were induced in a cell, and sigma 70 repressed, which of the following statements would be true?
A. The cell would have to synthesize new promoters in front of its genes.
B. 28 would not be able to recognize the same RNA polymerase as 70.
C. A whole new group of genes would be transcribed simultaneously.
D. Most of the genes transcribed by 70 would also be transcribed by 28.
E. RNA polymerase would produce the same number of mRNA molecules from each
gene with 28 as it did with 70
Most of the genes transcribed by 70 would also be transcribed by 28
130
The enzyme DNA polymerase . . .
A. begins replication by binding its sigma factor to a promoter
B. reads a template strand in either direction, depending on the direction of the Shine-Dalgarno sequence
C. adds a new nucleotide to the 5' end of an existing nucleotide
D. requires the hydrolysis of ATP to ADP in order to carry out its reaction
E. requires a short sequence of bases with a 3' OH to initiate its reaction
requires a short sequence of bases with a 3' OH to initiate its reaction
131
Which letter indicates an
Okazaki fragment?
A. A
B. B
C. C
D. D
E. E
E
132
What is the role of DNA gyrase in DNA replication?
A. It creates the primers to initiate replication.
B. It catalyzes the translocation reaction.
C. It uncoils DNA ahead of the replication fork.
D. It unzips the DNA by breaking hydrogen bonds at the replication fork.
E. It opens the bidirectional replication bubble at oriC
It uncoils DNA ahead of the replication fork.
133
Which of the following is needed to make RNA, but not to make DNA?
A. A primer
B. A sigma factor
C. A polymerase that can do proofreading
D. A template
E. An -OH group here
A sigma factor
134
RED HIGHLIGHTED
The gene depicted below is involved in N2 fixation. It is transcribed to the _________ using the _________ strand as the template.
A. left, top
B. left, bottom
C. right, top
D. right, bottom
E. there is no way to tel
left, top
135
Which of the following diagrams representing the DNA replication reaction is the most correct?
D - should be shown binding to the alpha phosphate but otherwise correct
136
What provides the energy for the DNA polymerase reaction?
A. the PMF, via a rotary motor called the DNA synthase
B. the reaction is coupled to pyrophosphate (P-P) hydrolysis by LeChatelier's principle
C. DNA polymerase hydrolyzes ATP in addition to carrying out the replication reaction
D. making hydrogen bonds between the bases of the template and the new strand
E. the reaction is spontaneous - no energy source is necessary
the reaction is coupled to pyrophosphate (P-P) hydrolysis by LeChatelier's principle
137
How does a bacterial cell know where to stop making RNA for a particular gene?
A. There is a stop codon present.
B. There is a specific sequence, called ter, 180 degrees from where the RNA started.
C. There is a hairpin loop in the DNA template.
D. A release factor enters the ribosome and causes the RNA to separate from the DNA.
E. There is a template sequence for which there are no complementary bases
There is a hairpin loop in the DNA template.
138
How does RNA polymerase determine which DNA strand to use as the template?
A. The template reads 3' to 5' in the direction the promoter is pointing.
B. The template is always the strand containing the promoter.
C. The template strand is the one opposite the -35 sequence.
D. The template strand is the one containing the 'AUG' sequence.
E. The template strand contains the best consensus sequence
The template reads 3' to 5' in the direction the promoter is pointing.
139
Why does a bacterial cell have multiple sigma factors?
A. Some are for transcription, others are for translation.
B. This allows the cell to coordinately transcribe genes with related functions.
C. A different sigma factor is required for each gene.
D. One sigma factor binds to the leading strand, and one to the lagging strand.
E. Some sigma factors activate gene transcription, while others repress transcription
This allows the cell to coordinately transcribe genes with related functions.
140
DNA polymerase needs all of the following EXCEPT _______ to replicate DNA.
A. a primer
B. a template it can read 3' to 5'
C. a promoter
D. dNTPs
E. a free 3' OH end
a promoter
141
Replicated DNA in bacteria contains one error about every 5 million base pairs. Transcribed RNA contains about one error every 5,000 bases. What is the difference due to?
A. DNA polymerase has a proofreading ability; RNA polymerase does not.
B. Thymine makes a better base pair with Adenine than Uracil does.
C. DNA can be repaired from a template; RNA uses no template.
D. DNA uses an RNA primer; RNA uses a DNA primer.
E. The 5' to 3' DNA synthesis is more precise than the 3' to 5' RNA synthesis
DNA polymerase has a proofreading ability; RNA polymerase does not.
142
What signals a bacterial cell to end transcription of a gene?
A. a terminator (ter) sequence
B. a hairpin loop
C. a stop codon
D. a Shine-Dalgarno sequence
E. the dissociation of the sigma subunit from the rest of the RNA polymerase
a hairpin loop
143
Which of the following is NOT true of the reaction carried out by DNA polymerase?
A. It needs a template and begins at a promoter.
B. It can be reversed by one step if the wrong nucleotide is used.
C. The energy for the reaction comes from the hydrolysis of pyrophosphate.
D. New nucleotides are always added to the 3' end of an existing polymer.
E. The enzyme moves along the template in the 3' to 5' direction.
It needs a template and begins at a promoter.
144
Which of the strands in the replication fork at the
right is the leading strand?
A. It cannot be determined.
B. The top strand.
C. The bottom strand.
D. It depends which strand contains the DNA polymerase.
E. It will change as the DNA polymerase moves along the DNA
The bottom strand.
145
Which of the following DNA replication enzymes is NOT correctly matched with its function?
A. Gyrase – relieves coiling tension ahead of the replication fork
B. Helicase – rewinds the DNA helix that the gyrase opens up
C. Primase – begins replication of each Okazaki fragment
D. Polymerase – dimeric enzyme that copies both the leading and lagging strands
E. All of the enzymes listed are correctly matched with their functions.
Helicase – rewinds the DNA helix that the gyrase opens up
146
The consensus sequences for several sigma factors are shown below. The sequence 5'- - - -CGGATA - - - - - - TTTAAA - - - - -3' is located as shown. Which of the following is the most accurate statement?
A. The gene will be transcribed by Sigma 54.
B. The gene will be transcribed by Sigma 70
C. The gene will not be transcribed because the consensus sequence is on the wrong strand.
D. The gene will only be transcribed with the help of an activator protein.
E. The -10 sequence of Sigma 32 will recognize the -35 sequence of the gene and transcribe it backwards.
The gene will only be transcribed with the help of an activator protein.
147
RED HIGHLIGHTED
The antibiotic Cipro (a quinolone) causes bacterial DNA replication to at first slow down, and eventually to stop. How does it do this?
A. It prevents the hydrolysis of pyrophosphate.
B. It blocks the proofreading function of DNA polymerase.
C. It prevents synthesis of primers.
D. It blocks the action of DNA gyrase.
E. It prevents Okazaki fragments from joining.
It blocks the action of DNA gyrase.
148
How many promoters are there in an average bacterial cell?
A. One
B. Fewer than ten
C. A few thousand
D. Several million
E. One per Okazaki fragment
A few thousand
149
We mentioned that the DNA polymerase reaction uses NTPs (nucleoside triphosphates). Why can't it also use nucleoside diphosphates?
A. They have no 3' OH group.
B. Their structure is so different that they wouldn't fit into DNA polymerase's active site.
C. Pyrophosphate wouldn't be produced from the polymerase reaction.
D. There is no way to make a phosphodiester bond with their 5' end.
E. Too few hydrogen bonds would mean that they don't pair well with the template strand
Pyrophosphate wouldn't be produced from the polymerase reaction.
150
Some viruses have an RNA genome rather than DNA, and so they use RNA polymerase for replication. What conclusion can you make about such viruses?
A. They always have single stranded genomes.
B. Their replication has a very high mutation rate.
C. Their template strand is read 5' to 3' rather than 3' to 5'.
D. They would use DNA primers to initiate replication.
E. The replication of their genome does not require hydrogen bonding
Their replication has a very high mutation rate
151
Because double stranded DNA as we know it is composed of antiparallel strands . . .
A. Okazaki fragments are generated during DNA replication
B. new nucleotides must be added to the 3' end of an existing polymer
C. DNA gyrase is required during DNA replication
D. template strands are always read in the 5' to 3' direction
E. two molecules of DNA polymerase are needed to replicate the DNA
Okazaki fragments are generated during DNA replication
152
Promoters of genes that are involved in the synthesis of the spore coat are indicated by arrows on the representation of a bacterial chromosome at right. How do you think a bacterium would most efficiently control spore coat biosynthesis?
A. by cassette switching
B. by collecting all the genes into an operon
C. by making the spore coat genes constitutive
D. by using a sporulation-specific alternate sigma factor
E. by using a separate activator or repressor protein for each gene
by using a sporulation-specific alternate sigma factor
153
The box on the diagram at right indicates a silent gene. Where would you clone the -10 and -35 sites on the template strand to allow this gene to be transcribed?
A. (-10 -35) on top to the right side of the block
154
Which of the following is NOT a difference between DNA polymerase and RNA polymerase?
A. The frequency of errors when copying a template strand
B. The number of places in a cell where the reaction is initiated
C. The direction in which the template is read
D. The size of the product produced by the reaction
E. The reaction proceeding bidirectionally
The direction in which the template is read
155
If the structure shown at right is introduced into a bacterium, what would happen?
A. It would block the promoter and stop transcription.
B. Because a base can't be added to it, it would stop replication.
C. It would prevent pyrophosphate hydrolysis and stop replication.
D. Because it can't be added to a primer, it would stop replication.
E. Normal replication – this is the normal structure of a nucleotide
Because a base can't be added to it, it would stop replication.
156
RED HIGHLIGHTED
A currently available antibacterial drug targets which of the following?
A. Primase
B. Promoter
C. Gyrase
D. DNA polymerase
E. Single strand binding proteins (SSBs)
Single strand binding proteins (SSBs)
157
Which of the following is true about DNA polymerase?
A. It gets the energy for DNA synthesis from ATP.
B. It requires a promoter to initiate its reaction.
C. To add a nucleotide to DNA there must be an -OH group here:
D. The lagging strand needs a template, but not the leading strand.
E. It has the ability to correct this mistake:
It has the ability to correct this mistake:
158
Which of the following proteins is NOT correctly matched with a function?
A. DNA gyrase – relieves coiling tension in the DNA helix ahead of the replication fork
B. Sigma – binds to the origin to initiate DNA replication
C. Primase – synthesizes the short RNA oligonucleotides required for replication
D. SSB proteins – prevent unreplicated DNA from interacting with itself
E. Helicase – unzips double stranded DNA at each replication fork
Sigma – binds to the origin to initiate DNA replication
159
Which of the following most correctly shows a DNA replication bubble?
D. blue solid arrow, red dashed arrow (every other) counterclockwise
160
What determines whether a region of a bacterial genome will be transcribed?
A. The presence of a start codon
B. Binding of an initiator protein to an RNA sequence
C. Binding of a part of RNA polymerase to a DNA sequence
D. The presence of a promoter
E. All DNA is eventually transcribed.
Binding of a part of RNA polymerase to a DNA sequence
161
How many different sigma factors are there in a typical bacterial cell?
A. Two; one for the leading strand and one for the lagging strand.
B. Two; one for the -10 and one for the -35 sequence
C. Three; one for each reading frame
D. Several; one for each commonly-encountered environmental condition
E. Thousands; a different one for each gene in the bacterial genome
Several; one for each commonly-encountered environmental condition
162
How does an amino acid recognize a specific codon?
A. hydrogen bonding between the amino acid and the codon
B. hydrogen bonding between the amino acid and the anticodon in tRNA
C. the ribosome rejects incorrectly paired amino acids
D. an aminoacyl tRNA synthetase attaches a specific amino acid to a specific tRNA
E. Sigma factor recognizes its -10 and -35 sites
an aminoacyl tRNA synthetase attaches a specific amino acid to a specific tRNA
163
We mentioned that one tRNA can recognize multiple codons by “wobble pairing.” For example, the tyrosine tRNA can recognize the codons UAU or UAC. In the diagram at the right, where could wobble pairing occur? (Hint: label all the 5’ and 3’ ends first.)
A. Position “1”
B. Position “2”
C. Position “3”
D. Position “4”
E. Position “2” and Position “3”
Position “1”
164
An insertion of one base into the coding region of a gene will do what?
A. Nothing
B. Will change the entire protein downstream of the insertion.
C. Will change the protein slightly, depending on where the base is inserted.
D. Will result in the insertion of one amino acid in the protein.
E. Will result in the insertion of three amino acids in the protein
Will change the entire protein downstream of the insertion.
165
Eukaryotic mRNA cannot encode more than one gene because . . .
A. it isn’t large enough to encode more
B. eukaryotes typically only have one large circular gene
C. the ribosome must start at the first AUG after the 5’ end of the mRNA
D. the mRNA can only have one stop codon
E. genes within exons would be spliced out of the translated message
the ribosome must start at the first AUG after the 5’ end of the mRNA
166
What is the function of an aminoacyl-tRNA synthetase?
A. to carry out the transpeptidation reaction
B. to help the tRNA find the A-site of the ribosome
C. to bind the tRNA to the Shine-Dalgarno sequence
D. to transcribe tRNA genes
E. to attach an amino acid to a specific tRNA
to attach an amino acid to a specific tRNA
167
Which of the following antibiotics does NOT affect protein synthesis?
A. Vancomycin
B. Streptomycin
C. Erythromycin
D. Chloramphenicol
E. Mupirosin
Vancomycin
168
The diagram represents a moment during the translation process. What would be the NEXT thing to happen?
A. The tRNA in the P site would exit the ribosome.
B. A new tRNA would enter the empty P site.
C. A peptide bond with Pro would transfer Met to the A site.
D. Transpeptidation would place Pro in the P site with Met.
E. The ribosome would translocate so CAA was in the A site.
A peptide bond with Pro would transfer Met to the A site.
169
There are 61 coding codons, but only 45 tRNAs. How can 45 tRNAs recognize 61 codons?
A. The 45 tRNAs still have 61 different anticodons.
B. Aminoacyl-tRNA synthetases allow the appropriate tRNA to match each codon.
C. The tRNA anticodons do not have to base-pair precisely with the codons.
D. The 5' end of the codon can shift by one base to match the tRNA in the A site.
E. The reading frame can vary to allow the same tRNA to read multiple codons.
The tRNA anticodons do not have to base-pair precisely with the codons.
170
We said that the antibiotic erythromycin "blocks the translocation reaction" to stop protein synthesis.
What does "blocks the translocation reaction" mean?
A. prevents the amino acids from entering the ribosome
B. prevents the ribosome from moving toward the 3' end of the mRNA
C. prevents the tRNA in the P site from leaving the ribosome
D. prevents the transfer of the amino acid from the A site to the P site
E. prevents the ribosome from finding the Shine-Dalgarno sequence
prevents the ribosome from moving toward the 3' end of the mRNA
171
What happens at a Shine-Dalgarno sequence?
A. Eukaryotic mRNA is spliced.
B. Prokaryotic DNA begins to be transcribed.
C. Eukaryotic ribosomes add the first amino acid to the start codon.
D. Prokaryotic ribosomes bind to mRNA.
E. Prokaryotic sigma factors bind to mRNA
Prokaryotic ribosomes bind to mRNA
172
How is the reading frame determined to begin eukaryotic protein synthesis?
A. It starts where the ribosome binds to the AUG codon in the promoter.
B. It starts at the first codon after the ribosome binding site.
C. It starts at the first AUG from the 5' end of the mRNA.
D. It starts at the first place RNA polymerase can insert a tRNA.
E. It can start anywhere on an mRNA where there is an AUG codon
It starts at the first AUG from the 5' end of the mRNA.
173
An mRNA codon is read by a tRNA. But what ensures that a tRNA is charged with the correct amino acid?
A. The tRNA anticodon binds specifically to the amino acid.
B. The tRNA in the A site is matched by the ribosome with the amino acid in the P site.
C. The tRNAs are produced with the amino acids already attached.
D. An aminoacyl-tRNA synthetase attaches a specific amino acid to a specific tRNA.
E. Nothing - the amino acid attachment to the tRNA is random.
An aminoacyl-tRNA synthetase attaches a specific amino acid to a specific tRNA.
174
The diagram at the right depicts the initiation step in translation. What is shown incorrectly?
A. The 'A' and 'E' sites are switched.
B. The tRNA should be in the A site.
C. The 5' and 3' ends are switched.
D. The small ribosomal subunit should not join the
complex until the second tRNA is added.
E. Nothing. The diagram is correct as shown.
The 'A' and 'E' sites are switched
175
It is believed that humans have only about 5 times as many different genes as the average bacterium, but we have 20 times as many different proteins. How is this possible?
A. Humans have more codons in their genetic code than bacteria do.
B. Each of our genes is translated more times than it is in bacteria.
C. Due to RNA splicing in humans, several proteins can be made from one gene.
D. Some proteins in humans are made from introns and not from genes.
E. It isn't possible. There are likely many human genes yet to be discovered
Due to RNA splicing in humans, several proteins can be made from one gene.
176
The MOST damaging mutation to a gene
A. insertion of a C into the coding sequence of a gene
B. insertion of CCC into the coding sequence of a gene
C. altering the 5' base in a codon from A to C
D. altering the 3' base in a codon from A to C
E. changing the codon UAA to UAC (please refer to the genetic code on page 1
insertion of a C into the coding sequence of a gene
177
The LEAST damaging mutation to a gene
A. insertion of a C into the coding sequence of a gene
B. insertion of CCC into the coding sequence of a gene
C. altering the 5' base in a codon from A to C
D. altering the 3' base in a codon from A to C
E. changing the codon UAA to UAC (please refer to the genetic code on page 1
changing the codon UAA to UAC (please refer to the genetic code on page 1
178
How will the tRNA shown at the right get charged with an amino acid? (Please refer to the genetic code on page 1.)
A. Thr will attach to the 3' end of the tRNA in the ribosome.
B. An enzyme will attach Arg to the 3' end of the tRNA.
C. An enzyme will attach Cys to the 5' end of the tRNA.
D. Ala will attach to the 5' end of the tRNA in the ribosome.
E. Thr will hydrogen bond to the tRNA anticodon sequence
An enzyme will attach Arg to the 3' end of the tRNA.
179
The diagram represents a moment during the translation process. What would be the NEXT thing to happen?
A. The tRNA in the A site would exit the ribosome.
B. A new tRNA would enter the empty P site.
C. Met would be transferred to the tRNA in the P site.
D. Transpeptidation would place Met and Pro in the A site.
E. The ribosome would translocate so CAA was in the A site.
The ribosome would translocate so CAA was in the A site.
180
What is a "codon"?
A. the part of the tRNA that recognizes a particular amino acid
B. the part of the ribosome that catalyzes the peptidyl transferase reaction
C. the sequence of nucleotides to which RNA polymerase binds
D. the part of the tRNA that recognizes the mRNA
E. a group of three mRNA nucleotides that represents an amino acid in a protein
a group of three mRNA nucleotides that represents an amino acid in a protein
181
The following sequence is a prokaryotic mRNA. The Shine-Dalgarno sequence is underlined. What would be the first three amino acids it encodes?
5'GAGCAUGCAACGGAGGCGGACAUGAAUUCAAGGCCAUGCAGGCCGUAGAUCGGAGCAA 3'
A. Met-Gln-Arg
B. Glu-His-Ala
C. Met-Pro-Asp
D. Met-Asn-Ser
E. Asn-Glu-Ala
Met-Asn-Ser
182
Because wobble-pairing can occur during translation, . . .
A. there are fewer than 61 different types of tRNA
B. sometimes frameshift mutations occur that damage a protein
C. more than one amino acid can be inserted in a protein at a particular place
D. a tRNA can be released through the E site of the ribosome
E. sometimes a tRNA can be inserted into the P-site of a ribosome
there are fewer than 61 different types of tRNA
183
In protein synthesis, the transpeptidation reaction
A. Moves the ribosome toward the 5' end of the mRNA
B. Makes a peptide bond
C. Brings a new tRNA to the A-site of the ribosome
D. Makes a peptide bond AND releases the protein from the ribosome
E. Makes a peptide bond AND transfers the protein to the tRNA in the A-site
Makes a peptide bond AND transfers the protein to the tRNA in the A-site
184
Which of the following mutations would be likely to cause the most damage to a cell?
A. Change of the codon 5' AUC 3' to 5' AUA 3'
B. Change of a tRNA gene's anticodon so that the tRNA could read a stop codon
C. Insertion of 3 bases in the middle of the coding region of a gene
D. Insertion of one base between the Shine-Dalgarno sequence and the first AUG
E. Deletion of the promoter from the gene that encodes cysteine-tRNA synthetase
Deletion of the promoter from the gene that encodes cysteine-tRNA synthetase
185
How will the tRNA shown at the right get charged with an amino acid? (Please refer to the genetic code.)
A. Thr will attach to the 3' end of the tRNA once
the tRNA is in the ribosome.
B. An enzyme will attach Cys to the 3' end of the
tRNA.
C. An enzyme will attach Arg to the 5' end of the
tRNA.
D. Ala will attach to the 5' end of the tRNA once
the tRNA is in the ribosome.
E. Thr will hydrogen bond to the tRNA anticodon
sequence.
An enzyme will attach Cys to the 3' end of the
tRNA.
186
Which of the following would best represent the first tRNA to enter a ribosome during protein translation? (The black oval represents the amino acid attached to the tRNA.
A. AUG
B. GUA
C. CAU
D. UAC
E. it depends what the sequence of the first codon in the reading frame is
CAU
187
What is the function of an aminoacyl-tRNA synthetase?
A. to synthesize a tRNA from intermediates in the Pentose Phosphate pathway
B. to charge a particular tRNA with a specific amino acid
C. to attach an amino acid to the appropriate mRNA codon
D. to attach an amino acid to the 5' end of a ribosome
E. to make sure that an anticodon matches the appropriate mRNA codon
to charge a particular tRNA with a specific amino acid
188
How can a single eukaryotic transcript be used to make more than one protein?
A. It can't. Only prokaryotes can do that.
B. It can contain more than one ribosome binding site.
C. Its genes can be arranged in an operon.
D. Its translation can be coordinated with its transcription.
E. Different exons can be combined during splicing of the transcript.
Different exons can be combined during splicing of the transcript.
189
Which of the following is true about the translocation reaction during protein translation?
A. It moves a ribosome so that a tRNA is in the A-site.
B. It moves a ribosome so that a tRNA is in the P-site.
C. It moves an amino acid onto the tRNA in the A-site.
D. It moves an amino acid onto a tRNA in the P-site.
E. It moves an amino acid to the A-site and a tRNA to the E-site
It moves a ribosome so that a tRNA is in the P-site.
190
Which of the following is carried out by the spliceosome?
A. removal of introns from eukaryotic RNA
B. removal of exons from prokaryotic RNA
C. removal of introns from eukaryotic DNA
D. removal of exons from eukaryotic RNA
E. removal of introns from prokaryotic DNA
removal of introns from eukaryotic RNA
191
Which of the following changes to DNA is most likely to cause a change to the protein?
A. Changing the 5' base in a codon
B. Changing the 3' base in a codon
C. Changing an anticodon so that it reads a stop codon
D. Inserting 3 bases into a gene's coding region
E. Deleting one base from a gene's coding region
Deleting one base from a gene's coding region
192
The active site of an aminoacyl-tRNA synthetase recognizes . . .
A. A DNA codon and an RNA anticodon
B. An amino acid and an mRNA codon
C. The charge on an amino acid and on RNA
D. An amino acid's R-group and a tRNA anticodon
E. A tRNA anticodon and an mRNA codon
An amino acid's R-group and a tRNA anticodon
193
The following is a snapshot of a moment during translation. Erythromycin blocks the translocation
reaction during protein synthesis. What would be the sequence of the peptide produced by this
ribosome if erythromycin was added right now?
A. Met-Arg
B. Met-Arg-Asp
C. Met-Arg-Gln
D. Met-Arg-Leu
E. Arg-Met
Met-Arg-Asp
194
Which of the following most correctly depicts a step in protein translation?
image of release of E and chain on P
195
A prokaryotic mRNA is shown below. How will the codons in this sequence be read? (A
significant sequence is underlined.)
5'-. . .GGCGAACAUGGAGGCTAGAUGCACCCUUCGCAGUACGU . . .-3'
A. AUG-ACG-CUU-CCC-ACG-UAG-CTA- . . .
B. AUG-GAG-GCT-AGA-UGC-ACC-CUU-CGC-AGU-ACG- . . .
C. AUG-UUC-GCC- . . .
D. CTA-GAU-GCA-CCC-UUC-GCA-GUA-CGU- . . .
E. AUG-CAC-CCU-UCG-CAG-UAC- . . .
AUG-CAC-CCU-UCG-CAG-UAC- . . .
196
Wobble pairing allows . . .
A. more than one amino acid to attach to a particular tRNA
B. more than one reading frame to be used for translation
C. the 5' base of the anticodon to recognize more than one 3' base of the codon
D. a ribosome to recognize more than one tRNA at a particular position
E. an amino acid to interact with more than one codon
the 5' base of the anticodon to recognize more than one 3' base of the codon
197
All of the following are consequences of coordinated transcription and translation EXCEPT
A. Prokaryotic genes are organized into operons
B. There can be no extensive gene splicing in prokaryotes
C. Translation in prokaryotes can begin before transcription has terminated
D. Ribosomes and RNA polymerase are in the same compartment in prokaryotic cells
E. The Shine-Dalgarno sequence is usually near the 5' end of a gene
Prokaryotic genes are organized into operons
198
The antibiotic mupirosin inhibits the isoleucyl-tRNA synthetase. How does this kill a cell?
A. It prevents tRNAs from forming.
B. It makes a ribosome stop at isoleucine codons.
C. It prevents the transpeptidation reaction.
D. It prevents the translocation reaction.
E. It causes other amino acids to be substituted for isoleucine.
It makes a ribosome stop at isoleucine codons
