Exam HT20 Flashcards by Andrew Bergman

Does mammalian cells fit the following descirption?

PTM: Nearly none
Speed (from plasmid –> expression): weeks
General costs including investments: low

No! The answer is suiting for e.coli.

How well did you know this?

Not at all

Perfectly

Does e.coli fit the following description?

PTM: Nearly none
Speed (from plasmid –> expression): weeks
General costs including investments: low

Yes.

No post-translational modifications. Quick expression from plasmids, and cheap.

How well did you know this?

Not at all

Perfectly

Does the following description fit BEVS?

Speed (from plasmid to expression): Months
General costs including investments: medium
PTM: some

Yes!

It’s a jack of all trades.

How well did you know this?

Not at all

Perfectly

Does the following descrption fit BEVS?

Speed (from plasmid to expression): Weeks or months.
General costs including investments: high
PTM: Nearly all

No. This is more fitting of mammalian cells than BEVS. BEVS TPM are somewhat occurring and the speed of expression is slow.

How well did you know this?

Not at all

Perfectly

What’s a VLP?

VLP = Virus-like particles.

VLPs are non-infectious because they don’t carry any viral genetic material. VLPs can be used as carriers for other genetic material.

How well did you know this?

Not at all

Perfectly

What’s a continuous cell line?

A continuous cell line has been immortalized and can thus grow forever. The immortalization can occur via hybridisation with a cancer cell line.

How well did you know this?

Not at all

Perfectly

Which of the following methods utilizes the 3’ –> 5’ activity of T4 polymerase?

Ligation independent cloning
Bac-to-Bac
FlashBac
Topo-TA
The gateway system

LIC.

The T4 exonuclease activity generates large 3’ overhangs which are he main driving force behind the ligation.

How well did you know this?

Not at all

Perfectly

Why do we add tags to recombinant proteins? Two answers are correct.

A. To allow affinity purification of the expressed protein
B. To increase the isoelectric point of the expressed protein
C. To increase the mass of the expressed protein
D. To improve solubility of the expressed protein
E. To decrease the pH of the expressed protein
F. To improve formation of inclusion bodies by the expressed protein
G. To allow the proteins to be analyzed by SDS-PAGE

A: To allow affinity purification of the expressed proteins (just like we did in the lab, using IMAC)

D. To improve the solubility of the expressed protein.

How well did you know this?

Not at all

Perfectly

What’s the elongated wording of “CHO cell line”. What are the benefits to the cell line?

Chinese ovary hamster cell line.

Benefits:
- Post-translational modifications occur in a huge extent.

How well did you know this?

Not at all

Perfectly

What’s methotrexate? Explain how DHFR and recombinant proteins are assocaited to it.

Methotrexate is a cytostatic drug which is similar to folic acid. In the CHO cell line, DHFR catalyses the formation of purines from folic acid.

In order for DHFR/methotrexate selection to work, you need to things:
1. DHFR defficicent CHO cell line.
2. Plasmid with gene of interest + DHFR

When introducing recombinant DNA to the CHO cell line, you conjugate the gene for DHFR to it. Then you cultivate the cell line in methotrexate. The dosage of methotrexate will increase over time, only the cells with proper incorporation of the recombinant plasmid will survive due to its surplus of DHFR. The cells which are not transfected do not have any DHFR, especially not a surplus which is required for mtx not to inhibit its function any way. This leads to them dying.

How well did you know this?

Not at all

Perfectly

Excess primers and unincorporated nucleotides can be enzymatically removed from an amplified PCR product. What enzymes are needed?
a. DNA polymerase combined with DNA kinase
b. Exonuclease I combined with alkaline phosphatase
c. Ribonuclease H combined with alkaline phosphatase
d. DNA ligase combined with topoisomeras I
e. Exonuclease I combined with DNA ligase

b. Exonuclease I combined with alkaline phosphatase

Reasoning:
The exonuclease 1 will cleave all remaining primers into individual nucleotides. The alkaline phosphatase dephsosphorylises the 5’ phosphate of the nucleotides, making them effectively useless.

How well did you know this?

Not at all

Perfectly

How does a bacterial cell protect its own DNA from restriction enzymes?
a. adding methyl groups to adenines and cytosines
b. using DNA ligase to seal the bacterial DNA into a closed circle
c. adding histones to protect the double-stranded DNA
d. forming “sticky ends” of bacterial DNA to prevent the enzyme from attaching
e. reinforcing the bacterial DNA structure with covalent phosphodiester bonds

a. adding methyl groups to adenines and cytosines

How well did you know this?

Not at all

Perfectly

The Gibson assembly reaction mixture does not include:
a. all four deoxynucleoside triphosphates.
b. dsDNA fragments with overlapping ends.
c. DNA ligase.
d. 5’ Exonuclease.
e. Oligonucleotide primers.

e. Oligonucleotide primers.

You don’t need primers, nucleotides are needed because the plasmid needs to be repaired in the organism which it’s being transformed to.

Im a little usnure.

How well did you know this?

Not at all

Perfectly

FRET is useful for nanoscale proximity detection in microscopy. This due to its inherent
a. linear distance dependence
b. inverse linear distance dependence
c. inverse-sixth-power distance dependence
d. non-radiative energy transfer
e. good dynamic range

c. inverse-sixth-power distance dependence

It is what it is.

How well did you know this?

Not at all

Perfectly

You would like to generate a DNA fragment with a single stranded overhang as shown below. Which of the following reagents do you need in your reaction mixture.
5´TACTTCCAATCCATG 3´
3´————–C 5´
a. E. coli DNA polymerase + dNTP
b. T4 DNA polymerase + dNTP
c. E. coli DNA polymerase +dGTP, dTTP, dATP
d. T4 DNA polymerase + dGTP, dTTP, dATP
e. T4 DNA polymerase + dCTP

e. T4 DNA polymerase + dCTP

T4 DNA polymerase has 3’ –> 5’ exonucleic activity. The activity is only available when there are no nucleiotides to be incorporated. Whenvever the exonuclease finds a base which it can build upon, the polymerase activity will start up.

How well did you know this?

Not at all

Perfectly

A small molecule that is not antigenic by itself, but is eliciting an immune response when attached to a large carrier molecule is called a
a. Nanobody
b. Hapten
c. Idiotope
d. Adjuvant
e. Epitope

b. Hapten

How well did you know this?

Not at all

Perfectly

During agarose gel electrophoresis most of the power is dissipated as heat. Heating of the electrophoretic medium has the several effects. Which alternative is not correct?
a. An increased rate of diffusion of sample and buffer ions, leading to broadening of the separated samples.
b. The formation of convection currents, which leads to mixing of separated samples.
c. A decrease of buffer viscosity, and hence a reduction in the resistance of the medium.
d. An increase of buffer viscosity, and hence a reduction in the resistance of the medium.
e. Using a constant power eliminates fluctuations in heating

d. An increase of buffer viscosity, and hence a reduction in the resistance of the medium.

When you heat up a viscuous liquid, it’s very rare that the viscosity increases.

How well did you know this?

Not at all

Perfectly

Which of the alignments below was made with an affine gap penalty? Motivate your answer.

Alignment 1
ATCTAGTGTATAGTACATGCA
ATCTAG——-TACATGCA

Alignment 2
ATCTAGTGTATAGTACATGCA
ATGTA–G–TA—CATGCA

Affine gap penalty goes by the following function:

A + B*L.
- A = Gap opening penalty
- B = Nucleotide missing penalty
- L = length

A is usually higher than the continuing nucleotides which are missing due to them likely leading to the same functional defecit. With this knowledge, alignment 1 is likely due to affine gap penalty, as alignment 2 would have been punished severely for it’s 3 gaps vs 1 big gap.

The gap opening penalty is usually high, but not necessarily. You set the gap penalties empirically.

Illumina next-generation sequencing (NGS) technology uses clonal amplification and sequencing by synthesis (SBS) chemistry to enable rapid, accurate sequencing. This NGS technology can be used in different applications. Briefly explain the following applications:

a) Whole-genome resequencing (2p)

b) RNA_Seq (2p)

c) ChIP-Seq (2p)

a) Illumina sequencing can be used to resenquence genome using its patented bridge amplification method. The result of bridge amplification is thousands of DNA fragments which are associated to adapters. By having a sequence to compare the dfragments to, they are aligned. The alignment process is made easier by the pair-ended reads which illumine can generate. That way you know the adapter length / identity, as well as the read length.

b) RNAseq works identically to how DNAseq would. The transcripts are not necessarily pieced together, but rather, the relative transcript amounts are generated.

c)ChIP seq is when you sequence the DNA which you’ve probed and captured with an antibody.

Which are the key components of the bacterial T7 recombinant protein production system?

T7 is promoted by the lac-promoter. The promoter is repressed by lacI until lactose or IPTG is present.
If lactose/IPTG is present, T7 polymerase is transcribed and translated, it can now go on and bind to its promoter.
T7 binds to the plasmid which has been transformed into the bacteria, transcribes the contents, which also include lacI, which will then repress T7.
Tighter regulation can be achieved by transforming a T7 lysozyme plasmid which is promoted by T7, and then creates a lysozyme which breaks down the remiaing active polymerase at the same time as lacI represses the new-formation of the polymerase.

(MC/1p) Write the formula that you should use for calculation of the relative centrifugal field (RCF).

1.12e-5(RPM)^2 * r

Order the folling RNA based on abundance in the cells: rRNA, mRNA, tRNA.

rRNA (70-80%)
tRNA (15%)
mRNA (1-5%)

What differentiates plant RNA from human and bacterial RNA when running them on an agarose gel?

Human RNA: 18s (1.9kb), 28s (5 kb) are present.

Bacterial RNA: 16s (2.9),23s (2.5kb) are present.

Plant RNA: 16s, 18s, 23s, 25s are present.

On an agarose gel where RNA is ran, where would you find degraded RNA?

At the bottom of the samples’ wells (they run fast and cause a smear).

On an agarose gel where RNA is ran, where would you find any remaining DNA?

DNA would be found in (hopeully) a very small quantity on the top of the gel.

Where would you find ncRNA and mRNA in an agarose gel loaded with all cellular RNA?

ncRNA are very small RNAs, you'd find them near the bottom. mRNAs: Depending on what organism you're looking at, you can identify the pronounced rRNAs and navigate from them. In human RNA, you'll find 18s (1.9kb) and 28s (5kb). In relation to these rRNAs, the mRNAs would have ran longer than 18s (they are 200-1000 bp long).

The following 3 primers are made in order to illustrate one design error each. Which are these? Also describe what consequence each design error should have for the (1) efficiency (direct or indirect) and the (2) specificity of production of the wanted product in a PCR reaction (with a suitable counter primer)? Motivate! NB! These primers are not supposed to be used together in pairs, but you should evaluate them one-by-one. a) 5'-TAGTATCAGGTACATCGCGAT-3' b) 5’-CACACTCCCAATCCTTACTC-3’ c) 5’-AGTCAGTCAGTCAGTCAGTC-3’

a) There are 8 GCs (31%). This is low. The low GC content --> Low annealing stability --> Low Tm. b) There are no G's present in the primer. Simple regions ma lead to a strand 2D structure (non-linear primer) (?) c) There are repeats of CAG TCA AGT GTC. Simple repeats can generate secondary binding sites for primers. Stable hybridization to secondary binding sites results in nonspecific amplification. Repeats >3-4. Maybe? Idk feller.

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each) a) It/they can (directly or indirectly) give you a fully quantitative (i.e. not "semi-quantitative") measure of mRNA levels

RNA seq, RT-PCR (using spike in transcripts and competitive product amplification respectively)

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each) c) It has the highest sensitivity in quantifying low-abundance mRNAs

RNAseq, more specifically - FLASHSEQ (FS) https://www.nature.com/articles/s41587-022-01312-3

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each) d) It/they can tell you where inside a cell that an mRNA is present

In situ hybridization Reporter gene analysis (i interpret reporter genes as being overexpressed genes w/ fluorescence characteristics which can be traced within a cell. In order for them to work, you'd likely want to KO the endogenous mRNA).

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each) e) It/they can be used to give a measure of the in vivo activity of a promoter

Reporter gene analysis. You generate transgenic animals which host the gene, this can LIKELY be done with CRISPR/cas or Cre-LoxP reccombination.

Real-time RT-PCR, Northern blotting, In situ hybridisation, RNA seq and Reporter gene analysis can all be used for investigating different aspects of gene expression. In this context, denote for each postulate below, which of the methods it is valid for. Wrong suggestions will lead to deductions inside a part question, but the point for each subquestion can never become less than zero. (1p each) g) It/they can tell you the length of one or several mRNAs at the same time that it is quantified

RNAseq? It cant be in situ hybridisation, northern blotting or reporter gene assay. I don't think it can be RT-PCR either since the fluorescence is non-specific to the elongted transcript. If you use taqman probes / molecular beacons you would get an idea, but norel confirmation to the length of the amplicon.

In situ hybridisation. - Hybrdigises directly to the RNA RNA seq - The direct RNA sequencing platform offered by Oxford Nanopore Technologies allows for direct measurement of RNA molecules without the need of conversion to complementary DNA, fragmentation or amplification. As such, it is virtually capable of detecting any given RNA modification present in the molecule that is being sequenced, as well as provide polyA tail length estimations at the level of individual RNA molecules.

RNA seq RT-PCR - Design primer for exon.

Mark each statement below. Write True if it is completely correct. Mark it FALSE if it is wrong in one or several aspects, and underline the word or words that make it wrong. (1p per statement) Knock-in is just another term for standard over-expression.

It's not a standard overexpression. A knock-in means that ou REPLACE the endogenous gene with another copy. It's often used to model diseases.

c) Assume that you want to introduce a specific change in your gene of interest, for example change it to an allele with one base substitution at a specific position of the gene. What do you need to do to get such a specifc change into the chromosomal locus after the dsDNA break has been introduced by CRISPR/Cas9? What mechanism in the cell would be involved? (1.5p)

I would generate a dsDNA break w/ CRISPR/Cas9. I would then transfect a repair templatewhich hosts the substitution as well as a screenable marker. Another way to generate the substitution would be by making CRISPR/cas9 catalytically dead and conjugate an enzyme which changes nts, like cytosine deaminase which turns C --> U --> T.

You have genetically modified mouse embryonic stem cells to express a fluorescently tagged protein and you would like to obtain transgenic mice that stably express the protein throughout their whole body. You have a female mouse that was fertilized three days ago, as well as a female mouse that was treated with hormones to be pseudo-pregnant. Describe how you would obtain a stably transformed fully transgenic mouse.

Viral vector or via microinjection of DNA. The genetic material will be incorporated via NHEJ. You could also use programmable nucleases that cause dsDNA break which will be repaired by co-transformed repair template. https://blog.addgene.org/mouse-modeling-part-1-genetically-engineered-mice

What is the name of the plot used by crystallographers to map different zones of crystal growth? [1 point]

Phase diagram.

Name two methods for preparing crystallization drops that are commonly used. [0.5 + 0.5 points]

Batch Vapour diffusion Dialysis

Name the two ways that neutrons can be produced in large scale research facilities. [0.5 + 0.5 points]

1. Decay of U235 --> neutrons grathered becore they facilitate further decay. 2. Spallation source. Collide atoms so that they break, collect neutrons.

How do we prepare deuterium-labeled proteins for neutron scattering? [1 point]

You can achieve deuterisation by producing the protein in absence of hydrogen. The cells must metabolise deuterium and produce their cellular components using it instead of hydrogen. It is achieved by having D2O, sugars hosting deuterium and so on.

Q1 (1 p) Which natural physical principle underlies production of the radiation used at MAX IV. What is it called and how is it produced?

Synchrotron radiation: Electromagnetic radiation is generated when particles are accelerated radially.

Q3 (2 p) How do you envision MAX IV can become a tool in your own research or on a research case that you know or could imagine? Mention the research field to which the project will belong to, the fundamental kind of information that you could obtain from the measurements and if possible, a hint on why or for what that could be useful or important. Example: Solar energy. Identify and optimize (bandgap and stability) suitable quantum dots (QDs) for solar cells.

Drug development. You would be able to characterize the electrostatic interactions which occur throughtout the pharamceutical compound. Electrons / photons.