FINAL MC Flashcards
1
Q
What are the Advantages of Protein Expression in Yeast vs bacteria?
A
- Protein folding
- Post translational modifications such as phosphorylation, adding sugar residues
- Secretion (proteins targeted to various organelles or exported for harvesting)
- Vectors can be maintained as PLASMIDS or INTEGRATED
2
Q
What are the disadvantages of Protein Expression in Yeast vs bacteria?
A
-Higher number of recombination events
-Longer growth time
-Post translational modifications such as glycosylation may be different when compared to human proteins
(hyper glycosylation of secreted glycoproteins can be observed)
3
Q
What are the advantages of yeasts vs other eukaryotes?
A
- LESS EXPENSIVE, EASIER TO GROW, HIGH THROUGHPUT- you get a lot for the amount of time you spent.
- Shorter cell cycle than tissue culture
- Transformation/DNA manipulations easier
- HIGHER PROTEIN YIELD
- Protein pharmaceuticals free of human disease (don’t have to worry about yeast becoming infected with some virus or something that can infect a human that consumes)
- Fewer regulations compared to tissue culture
- More extensive genetics
4
Q
What are the disadvantages of yeasts vs. other eukaryotes
A
- Glycosylation in yeast can be different (usually adds extra glycosol groups to proteins)
- In the ER membrane there is protein generation/modifications and sometimes they get stuck there so they can’t secrete
- it is a lower eukaryote so not as many genes
5
Q
Which of the following is NOT an advantage of yeast expression systems?
A) High protein Yield
B)Hyper glycosylation of protein products
C)Vectors can be maintained as plasmids or integrated into the chromosome
D)Fewer regulations compared to tissue culture systems
A
B) hyper glycosylation of protein products
6
Q
What are the transformation methods for yeast?
A
1) Spheroplast preparation-production of wall-less yeast cells with enzymes and fused with PEG in the presence of CaCl2 and DNA (NOT USED OFTEN)
2) Lithium acetate wash-mimic any electrical charges with the lithium acetate wash, PEG, and heat shock to get DNA into the cell
3) Electroporation: heat shock and hope the DNA gets into the cells
7
Q
Selection of transformants for yeast
A
- complementation markers (URA3, LEU2, TRP1, HIS3)
2. Dominant Selection Markers (resistance to antibodies such as G418, hygromycin, or Zeocin)
8
Q
Yeast can be transformed by.... A) Electroporation B) Use of dominant markers C)Spheroplast production D) Lithium acetate treatment and heat shock E) A, B, and C F) A, C, and D
A
F
9
Q
Why use P. Pastoris for Protein Expression?
A
Like Saccharomyces cervisiae:
- Easy to manipulate
- Faster, easier, less expensive than other eukaryotic systems
Advantages over Saccharomyces:
-10-100 FOLD HIGHER HETEROLOGOUS PROTEIN EXPRESSION LEVELS
Grows to extremely high cell densities
Intracellular or secreted protein:
- Pichia Pastoris secretes low levels of native protein
- Easier Purification
10
Q
Insulin
A
is being produced by S. Cerevisiae under the product NOVOLOG
11
Q
Hep. B virus surface antigen
A
is being produced by Pichia Pastoris under the product Hep. B vaccine
12
Q
MCSF- macrophage colony stimulating factor
A
is being produced in S. cervesiae under the produce Leukine
13
Q
Bone Marrow transplants
A
treat with high levels of GMCSF-cytokine that causes immature bone marrow cells to become mature immune cells. High doses goes to the blood, only treat for a few days then collect blood and put into the patient
14
Q
Xylanase
A
Industrial Enzyme produced in yeast
-breaks down hemicellulose
Uses:
- pulp and paper
- textile industry
- animal feed
15
Q
Cellulase
A
Industrial enzyme produced in yeast
-breaks down lignin/cellulose
Uses:
- animal feed
- ethanol production
16
Q
What are some other uses of other industrial enzymes used in yeast?
A
production of wine
extraction of olive oil
fermentation of tea, coffee, and cocoa
17
Q
Yeasts are used to produce many valuable therapeutics for human use. What is one advantage of yeast over E. coli in terms of production of recombinant proteins.
A)High protein yield
B) ability to glycosylate proteins so that they resemble human proteins
C) variety of promoters available including constitutive and inducible promoters
A
B) ability to glycosylate proteins so that they resemble human proteins
18
Q
Why use PLANTS for the generation of recombinant proteins?
A
Plants LIKE YEAST are not contaminated by bacterial or mammalian borne pathogens
Engineer plants that are resistant to pesticides and herbicides, grow larger, or stay fresh longer.
- Bt corn and soybeans express a toxin from Baccillus Thuringiensis
- HT (herbicide tolerant) corn and soybeans express C4 EPSPS, making crop resistant to the herbicide glyphosate
Easy way to administer drugs/vaccines to individuals.
- problem is that it expensive, its to grow in third world countries, people would have to eat a good amount to get the protection that they
- Vitamin A-expressing bananas
- rice that expresses a vaccine for Cholera
19
Q
Arabidopsis Thaliana
A
- WEEDS
- compared to tobacco it has a relatively small genome
- produces many seeds
- cheap and easy to grow
- small so do not need a lot of growing space
- short life span (6 weeks seed to germinate and develop into mature plants)
- small genome compared to other plants
- genome has been sequenced
- efficient transformation with Agrobacterium Tumefaciens
20
Q
Plant Tranformation Agrobacterium tumefaciens
A
- clone your gene of interest into agrobacterium. Its in specific plasma called a TI plasmid
- Biolistic or microparticle bombardent: gene uncoats your DNA onto gold or tungsten particles that act as bullets, and use very high pressurized chamber with vacuum. This will cause wounds and allow DNA to get into cell.
- Protoplast fusion
- Have a screen for both to make sure its in the cell
21
Q
Stable vs. Transient transformants by using the Gene gun
A
Stable transformants: can be generated if bombarding undifferentiated cells; select for cells that received DNA. Tissue culture required
Transient Transformants: can be generated if bombarding WHOLE PLANTS, as not all cells of the plant will receive DNA
22
Q
Stable vs. Transient transformants by using AGRO
A
Stable transformants generate by floral dip and collection of seeds
Transient transformants generated by leaf infiltration
23
Q
Stable transformants
A
maintain same DNA throughout life
24
Q
transient Transformants
A
usually top leaves of the plants get more DNA
25
Selectable marker genes for stable transformants
allow for the selection of transformed cells by their ability to grow in the presence of antibiotics or herbicides
- antibiotics: kanamycin and hygromycin
- herbicides: glyphosphate and glufosinate
26
Screenable marker fore genes for stable transformants
allows not only for the selection of transformed cell, but gives an estimate of where trangene expression is located and the levels of transgene expression
- Enzymes such as beta-glucuronidase (GUS), chloramphenicol acetyl transferase (CAT), luciferase, GFP, or beta-galactosidase
- Enzyme activity is determined by histochemical staining or fluorometric assay
27
Mammalian Cell transfection
- Procedure to introduce foreign nucleic acids into cells to produce genetically modified cells
- study gene function and regulation as well as protein function
- produce recombinant protein
28
Types of transfection
-Transfection same process of transformation just called that bc its in mammalian cells
1) stable:
- genetic materials are integrated into the host genome
- genes expressed after host cells replicates
2) Transient:
- genes only expressed for a finite period of time
- Genes can be lost by environmental factors or cell replication
29
Why do mammalian cell transfection?
Gene Therapy:
- good for diseases that don't have pharmaceutical inhibitor that would restore function of the gene
- Adding a gene into cells to replace a defective gene or lack of a gene
- Therapy for neurological diseaeses, chronic diseases, and some forms of cancers since ether don't have great treatment options
- Cure diseases, the patients still have the mutation that caused the disease but decreased symptoms
iPS cells
- commonly taken from the skin
- transfect cell with the addition of three or four transcription factors to revert differentiated cells
- can give rise to any fetal or adult cell type
- many possibilities
RNA interference:
- mRNA is made but it actually chews up the mRNA so the protein isn't made or isn't made in its normal levels.
- Any disease where decreasing a genes product is beneficial
- Decreases gene product, post-transcriptional
30
Mammalian Cell Transfection Methods Characteristics
METHOD used will depend on your cell type and purpose
-ideally, methods should have high transfection efficiency, low toxicity, minimal effects on physiology, easy to use, and reproducible
31
Biological method of mammalian cell transfection
Ex: virus-mediated (transduction)
| -high-efficiency, easy to use, effective on cells, slices and in vivo
32
Chemical method of mammalian cell transfection
Ex: cationic polymer, cationic lipid (most commonly used), calcium phosphate
-No viral vector (TRansduction), high-efficiency, easy to use, easily purchased, effective on cells and slices
33
Physical method of mammalian cell transfection
Ex: direct injection, electroporation, biolistic particle delivery, laser-irradiation, etc.
-Straight forward, no need for vector, physical relocation of nucleic acids into cell, less dependent on cell type and condition, single cell
34
```
Which type of transfection depends upon the integration of foreign DNA into the host genome?
A) Stable
B) Transient
C) Direct
D) Indirect
```
A) Stable
35
```
Which method involves using virus to deliver foreign DNA into the host genome?
A) Transfection
B) Transduction
C)Electroporation
D) Nucleofection
```
B) Transduction
36
```
Which method is NOT suitable for incorporating nucleic acids into mammalian cells?
A) Transduction
B) Cationic Lipids
C) injection
D)Electrical Current
E) They are all suitable
F) none are suitable
```
E) THey are all suitable
37
What is the solution to this problem:
Problem: You want to express a protein, but you aren’t sure whether it would be best expressed in E. coli, mammalian cell culture, yeast cells, insect, or plants.
Or what type of fusion tag would work best and if it would be better C or N terminally.
clone genes in frame into a Gateway donor vector (ENTRY Clone), and then move easily into multiple expression vectors
38
The purpose of Gateway cloning is to:
A) streamline the act of moving a gene into multiple vectors/hosts
B) Quantitate transcription of all the genes on the genome
C)Clone a gene of interest into E. Coli in the easiest, quickest manner
D)Rapidly determine the nucleotide sequence of a gene
A) streamline the act of moving a gene into multiple vectors/hosts
39
Look at gate way cloning and chart at the end of 4/6 lecture
!
40
What is evaluated when measuring gene expression of eukaryotic organisms?
the presence and/or amount of mature mRNA
| -should always follow-up with protein expression assays to assess translational regulation
41
Bacteria transcription and translation
RNA polymer sometimes transcription factors bind to promoters
- mRNA is translated by a ribosome into protein. This occurs in the cytoplasm of the bacteria
- single ORF
-bacteria contain multiple genes controlled by a single promoter, a single mRNA transcript is made, and multiple proteins are made (operon)
42
Eukaryotic transcription and translation
Have a promoter and Ribosome binding site (RBS). ORF is broken up into segments
- Contains exons and introns
- introns could code for alternative splicing sites NOT JUNK or miRNA coding regions
- Transcription occurs and still have RBS, eons, and introns. mRNA is turned into mature mRNA by adding a 5' cap and 3' poly A tail and introns spliced out
- All occurs in the nucleus of the eukaryotic cell. Then shuttled out via the ribosome. The 5' cap prevents degradation/stabilizes from exonucleases. Also, the 5' cap is used for binding of the Ribosome
-SIGNALING for nuclear export. Also, used for processing/splicing removal of introns from pre-mRNA
43
Eukaryotic mRNA isolation
1. Lyse cells and treat with DNase. Treat with DNase because you want RNA contaminated with RNA
2. Run cellular content over OLIGO (DT) COLUMN to bind poly(A) RNA. Oligo (dt) column similar to affinity chromatography. Has a string of T's that bind to the 3' Poly A tail/
- mRNA is immobilized on the column
- all other cellular impurities, including ribosomal, and tRNAs run through
3. Wash column
4. Elute mRNA from column so you have nice pure mRNA. mRNA is a very small portion 1-2% of the total mRNA in the cell.
44
Problems with RNases
- resistant to chelation
- resistant to autoclaving
- found on skin, in water, in samples (everywhere)
45
Solutions when dealing with RNases
Diethylpropcarbonate (DEPC) treatment inactivates RNases, but DEPC doesn't last forever
- Wear Gloves ( and change often)
- Purchase RNase free water and buffers
- Use RNase free micropippette tips that have an aerosol barrier
- work quickly and keep samples cold
46
How do you make cDNA from mRNA
1) add primers (oligo d(t) primer), which binds to 3' poly A tail. Then add reverse transcriptase. You end up with a hybrid molecule where one strand is mRNA and one is cDNA. FIRST STRAND cDNA Synthesis
2) Nicking Step: add RNase H-randomly which chew up the mrNA sequence called the nicking step
3) Second Strand cDNA synthesis: add DNA polymerase such as Vent, then add dNTPs and DNA ligase
47
Type of Primers for the first step of the first strand cDNA synthesis
- Oligo (dT) primers, 12-20 nt in length, which bind the poly(A) tail of mRNA
- Specific primers specifically designed to anneal to the cDNA sequence of interest. Use only if wanting to generate specific cDNA.
- Random Hexamers: randomly generated 6 nt oligos that will anneal randomly to mRNA. Get better cDNA so preferred
Reverse Transcription has low processivity: it will not copy all of a long mRNA (likely have to use more than one primer per mRNA molecule)
-Processivity: the average number of nt added by a polymerase per association/dissociation with the template
48
Why is quantifying gene expressions (mRNA levels) of interest?
- find out what gives a cell certain characteristics (i.e., disease vs. healthy, brain vs lung)
- identify genes that combat a certain stressor (i.e. drug)
- identify genes in a regulatory pathway
**you can miss genes that are regulated at the translational level (or by microRNAs). This is, just because the message is present, doesn't mean that the protein is present(always follow up with protein study)
49
What would you do?
Baker’s yeast (Saccharomyces cerevisiae) has the ability to grow under aerobic and anaerobic conditions. You have been given a project to determine which genes are utilized under each condition. You want to be able to look at all genes at once.
So what technology would you use?
deep sequencing or high throughput sequencing is replacing microarray
50
What is the purpose of using microarrays?
is to examine the transcriptional regulation of whole genome at once
51
Microarray process
placed on a chip, use PCR to synthesize oligos or bunch of pieces of DNA that represent all genes in the organism. Then Robot spot on individual locations on that chip ssDNA Then use robots, will spot onto a glass chip
52
Cy3 and Cy5 experiment
Cy3 fluoresces Green (aerobic)
Cy5- Red (anaerobic DNA)
Mix together in equal ratios and allow to hybridize to the slide. Allow them to bind Robot do all of this.
- Fluorescent molecules bonded to nucleotides which are incorporated into cDNA during reverse transcription
- Fluorescent molecules absorb at a particular wavelength of light and emit at a different one; the experiment is set up with two dyes with separate emission peaks
53
Cy3 and Cy5 are examples of:
A) Fluorescent molecules that can be bound to nucleic acid for microarray analysis
B) specialized nucleotides that are used for microarray analysis
C) enzymes that assist samples in hybridizing to the microarray plate
A) Fluorescent molecules that can be bound to nucleic acid for microarray analysis
54
```
What sample is added to a microarray chip?
A) mRNA
B) cDNA
C) gDNA
D) protein
```
B) cDNA
55
Example: you are studying gene regulation of light versus dark cycles in zebrafish
What is the :
Biological replicate
Test RNA from several fish. Statsitics for variation among living entities
-testing for a specific gene
56
Example: you are studying gene regulation of light versus dark cycles in zebrafish
What ist he technical replicate
Test mRNA from one zebrafish on more than one chip (and/or more than one spot). Stats for variations arising from experimental procedure
-to make sure that the confidence for that particular zebra fish is 100% correct. Gonna run 3 samples from each zebrafish so 3 different times so that all of them match/make sense
57
Affymetrix Microarrays
-Affymetrix makes "gene chips" for model organisms. These have some advantages over "homemade" chips.
```
Affymetrix:
single dye: single sample per slide
-Oligo Probes
-available for model organism
-easier to compare multiple conditions
```
58
Homemade Microarrays
Double dye: always compare 2 samples/conditons
- longer probes
- custom
59
If you only have a couple genes to study some other techniques that could be used are?
- Northern Blotting; time consuming and outdated
| - Reverse Transcriptase PCR; simple, hard to quantify cDNA amount with convetional RT-PCR
60
Quantitative PCR or Real Time PCR
same thing
| -can be used to measure amounts of DNA or mRNA (quantitative reverse transcriptase PCR) present in sample
61
RT-PCR
reverse transcriptase PCR (non-quantitative)
62
qPCR detection methods
quantitative (real time) reverse transcriptase PCR
PCR signal (i.e. product) is detected in "real time" or as it appears in the reaction
New PCR products/amplicons= the products
1st method:
SYBR green: a dye that intercalates into double stranded DNA and fluoresces upon excitation
-Advantages: cheap, easy to use
-Disadvantages: can bind to primer dimers and non-specific PCR products (i.e. false positives)
-CAN AMPLIFY INTO ANYTHING
-Primer design is imperative
2nd Method:
TaqMan: fluorescent-labeled probe with quencher hybridizes to template DNA. When the probe is displaced by Taq polymerase, the quencher is released and the fluorescence is detected.
-Advantage: only specific PCR products are detected
-Disadvantages:expensive- need a different probe for each reaction
63
LOOK AT qPCR
!11 write out on to piece of paper
64
How do you quantitate for PCR results?
compare another sample to get relative values
-Standard curve to get absolute values
65
qPCR controls
No RT control: to make sure you don't have DNA contamination of original sample.
Negative control: to make sure your reagents are not contaminated
Internal control (housekeeping) standardize for number of cells
- same copy number and constitutively expressed in all cells
- exs: GAPDH, Tubulin, Beta-actin genes
66
```
If you wish to examine the effects of a chemical on the transcription of all genes in an organism’s genome, which method would be best to use?
A) northern blotting
B) qPCR
C) RT-PCR
D) Microarray
```
D) microarray
67
```
If you wish to quantify the transcriptional level of a single gene, which method would be best?
A)Northern Blotting
B) qPCR
C) RT-PCR
D) Microarray
```
B) qPCR
68
```
What dye, sometimes used in qPCR, only fluoresces when it’s incorporated into double stranded DNA
A) cy3
B) cy5
C) SYBR green
D) Taq Man
```
C) SYBR GENE
69
```
What type of probe, sometimes used in qPCR, only gives a signal once the dye is released from the quencher?
A) Cy3
B)Cy5
C) SYBR Green
D) Taq Man
```
D) Taq Man
70
Dicer
-is an ATP-dependent RNAIII-like protein which progressively cleaves the long dsRNA in small dsRNA
71
RISC
mRNA binding complex
72
Enodgenous pathway
miRNA
73
Exogenous pathway
siRNA
74
Plant biologists wanted to make purple petunias
Hypothesis: we know the genes involved in making the purple color.
What did they try and what was the outcome?
Tried to put in extra copies of the gene which encoded a key enzyme in flower pigmentation (chalchone synthase) hoping to make the plants darker, but instead they ended up with the complete opposite and the petunias turned white.
Expression from both the transgene and endogenous gene were suppressed, called this CO-SUPRESSION
75
Fire and Mello
injected C. elegant with double stranded RNA (dsRNA) and demonstrated that dsRNA was responsible for causing INTERFERENCE
Results:
-double stranded RNA resulted in potent silencing of gene involved in coordination (unc-22) whereas no silencing was seen if only sense or antisense alone was used.
dsRNA made them twitch
76
What are some plants that RNAi occurs in?
```
Petunia
Nicotiana (tobacco)
Arabidopsis
Tomato
Rice
Potato
```
called Post-transcriptional gene silencing
77
What animals does RNAi occur in?
```
invertebrates
-c. Elegans
-Drosophila
-Apis Mellifera
-Paramecium
-Planaria
-Hydra
Vertebrates:
-Zebrafish
-Mouse
-Humans
```
78
What fungi does RNAi occur in?
Neurospora
S. Pombe (fission Yeast)
S. Castellii and C. Albicans (budding yeast)
79
What is RNA interference?
- Mechanism to DOWN REGULATE gene expression (still have low levels of expression)
- RNAi occur when double stranded RNA interferes with the production of protein
- Primitive immune system for protection against viruses
- This "silencing" occurs in a sequence specific manner so that only the gene whose messenger RNA sequence matches that of double stranded RNA is affected
- complementary mRNA CAN EITHER BE TARGETED FOR DEGRADATION OR PREVENTED FROM BEING TRANSLATED. either way, protein is not made and gene expression has been suppressed
80
What are the endogenous roles of RNAi
The function of RNAi mechanism in organisms:
1. Protection against viruses (retroviruses) that inject RNAI into cell (both ss and ds)
2. Keep transposable elements inactive; RNAi is an ancient defense mechanism for plants and worms against viral infections, active transposons (mobile DNA elements) and aberrant RNAs. End result is mRNA cleavage and degradation
3. Gene Regulation
- one class of small RNAs, microRNAs, has been shown to be important in developmental regulation via translational repression.
- RNAi can also lead to silencing of gene transcription by directing heterochromatin formation using repeat associated siRNAs
81
How is dsRNA recognized in an infected host?
dsRNA is recognized by interferon proteins of the host immune system or RNAi apparatus
-Viruses will often have proteins to interfere witht he interferon response in order to try to avoid detection
82
What are the small double stranded RNAs made by Dicer called?
small interfering RNAs (siRNAs). They are 19-25 base pairs double-stranded duplexes with 2 nucleotide 3' overhangs to yield 21-27 nucleotides total, with a 5' phosphate and 3' hydroxyl group
83
How is RISC formed? and what does it do?
Dicer and a binding partner (BP) load the siRNAs into a RNA-Induced Silencing Complex(RISC)
-also recruits agronon
RISC processes the siRNAs so that they will be able to interact with complementary mRNA
84
How does RISC know which strand to keep and which to cleave?
- Dicer binds less thermodynamically stable end of siRNA duplex ( more easily unwound)
- BP binds more stable end
- 5' strand from the less stable end is retained in RISC complex (guide strand)
85
Which of the following is NOT a job performed by RISC?
A) binding to double stranded RNAs
B) unwinding double stranded siRNAs
C) cleaving double stranded RNAs into siRNAs
D)Targeting complementary mRNA molecules
C) cleaving double stranded RNAs into siRNAs
86
Technically what happened in the petunia dealing with RNAi
plant considered the material introduced as foreign and mounted an RNAi response.
- The guide sequence in RISC matched the sequence front eh chalcone synthase
- mRNA from both the additional copies and the endogenous copy was destroyed, either partially or completely
87
Is siRNA processed by Dicer?
yes
88
Is siRNA exogenous or endogenous?
exogenous
89
is sRNA complementarity to target?
Perfect match
90
What is the result of siRNA after binding with target?
mRNA
| cleavage and degradation
91
Is miRNA exogenous or endogenous?
endogenous
92
is miRNA processed by Dicer
Yes
93
Is miRNA a substrate for RISC
YES
94
is miRNA complementary to target?
imperfect match
95
What is the result of miRNA after binding with target?
Translational repression
| **important exception in plants, miRNAs mainly lead to mRNA cleavage and degradation
96
miRNAs and cancer
miRNAs regulate many genes involved in differentiation, therefore, if miRNA function is altered, cancer may result
97
Dr. Carson is interested in knocking down the expression of the slpE gene in her students. She designs a small RNA molecule that is perfectly complementary. What is the most likely outcome?
A) the small RNA molecule gets amplified in the amplification pathway
B)slpE DNA gets cleaved and degraded
C) slpE mRNA gets translationally repressed
D) slpE mRNA gets cleaved and degraded
E) Both A and D
D) slpE mRNA gets cleaved and degraded
98
what does an A260/280 of 1.8 indicate?
indicates optimal purity of double stranded DNA
99
What method was used to separate plasmid from chromosomal DNA in lab?
alkaline lysis
100
Why will you use two different restriction enzymes to cut the vector pET-41a
Because cutting the vector with two enzymes that leave incompatible ends and then cutting the insert withe same two enzymes will force the insert into the correct orientation when cloning
101
What is the basis for selecting the annealing temperature to use in a specific PCR reaction?
A)the length and GC content of the primers
B) the restriction sites engineered into the primers
C) the length and GC content of the desired PCR product
D) the ideal reaction temperature of the polymerase
C)the length and GC content of the desired PCR product
102
In DNA agarose gel electrophoresis, which side of the apparatus would your wells be closer to?
A) the red side (anode)
B) the black side (cathode)
B) the black side (cathode)
103
```
What DNA serves as the template to amplify egfp in PCR?
A) egfpNCO and egfpNOT
B)pEGFP-N1
C)egfpNot
D)egfpNCO
E)pET-41a
```
B) pEGFP-N1
104
What is the purpose of running our digested vector through the spin column?
A) to remove unwanted salts prior to ligation
B) to remove and live E. Coli that might be mixed in the sample
C) To remove any live E. COli that might be mixed in the sample. AND to remove Restriction enzymes from the digest. AND to remove unwanted unwanted salts prior to ligation
D)To remove restriction enzymes from the digest
E) To remove restriction enzymes from the digest and to remove unwanted salts prior to ligation?
E) to remove restriction enzymes from the digest and remove unwanted salts prior to ligation
105
True or False: Because a 73 base pair fragment is removed from pET-41a during a digestion, the uncut vector should always run slower through the agarose gel than the cut/digested vector.
false
106
```
If your nano drop reading was 75 ng/ul, what volume of PCR product would you need to add to your restriction digest?
A) 6670 uL
B) 6.67 uL
C) .15 uL
D) 150 uL
```
B) 6.67 uL
LAB 4 material
107
What is a purpose of taking a nano drop reading of your PCR Product?
A) to determine concentration of DNA
B) to determine the fluorescence intensity of egfp
C) to determine whether you have non-specific PCR products
D) to determine the volume of DNA
A) to determine concentration of DNA
108
If your clean digested egfp PCR product has a concentration of 7 ng/uL, what volume would you need to use to have 21 ng for the following weeks ligation?
3 microliters/uL
109
What should you do if you have an aliquot of enzyme and cannot pipette the entire volume out of your tube?
C) vortex
D) Try to centrifuge down the liquid for 5 seconds
D) try to centrifuge down the liquid for 5 secs.
110
For optimal transformation efficiency in E. Coli competent cells, the pET-41a vector with the egfp insert should be linearized. T or F
False
111
T or F: ligase buffer does not need to be kept on ice when not in use since it is active at room temps.
false
112
What is the vector insert ratio we used in lab
1:3
113
What control will be included to ensure the cell are competent?
uncut pET-41a
114
T or F: you should gently mix competent cells by flicking the tube instead of vortexing them before use in a transformation.
True
115
What is true about GAMP:
A) it is the secondary antibody
B) it binds specifically to the alpha-EGFP primary Antibody
C) it has horseradish peroxidase conjugated to one end to be used as a means of detection
D) all of the above
D) all of the above
116
In the PCR screen, how are the primers designed?
A) one is designed to bind insert DNA and one is designed to bind adjacent vector DNA
B)Both are designed to bind to opposite ends of the insert DNA
C) both are designed to bind to vector DNA, on opposite sides of the insert
D) both are designed to bind to vector DNA, on the same side of the insert
A) one is designed to bind insert DNA and one is designed to bind adjacent vector DNA
117
In your PCR screen, what would you expect to see when you run your PCR product on a gel if you had a negative clone (clone with no insert)
A) one band about 1500 bp
B) two bands
C) no bands
C) no bands
118
What size do you expect your PCR product to be from the screening experiment for clones that have the egfp gene?
for PCR you wouldn't see any part of the vector, just the fragment that your amplified, which we expect to be approximately 1.2kb.
119
The mini prep protocol performed in lab used alkaline lysis to purify the plasmid DNA. T or F
True
120
What is the purpose of preparing a master mix?
A) minimize error inherent in pipetting smaller volumes
B) reducing variability between samples
C) saves time
D) all of the above
D) all of the above
121
What precaution must you take when looking at your IPTG plate on the UV box?
When viewing the transformants on the UV box make sure you are wearing a UV protective face shield and protect any skin from direct exposure to the UV light by wearing a lab coat and/or gloves.
122
Why does one sequence positive clones derived from PCR cloning?
The main disadvantage is that errors can be incorporated into the sequence during PCR. We need to sequence the DNA to assure that we won't be working with a mutated version of our protein instead of our expected protein.
123
```
In SDS-PAGE, what chemical is used to ensure that all protein molecules are coated with a negative charge?
A) X-gal
B) B-mercaptoethanol
C) SDS
D) IPTG
```
C) SDS
124
```
In SDS-Page, what chemical is used to ensure that protein disulfide bonds are broken?
A) B-mercaptoethanol
B) X- gal
C) IPTG
D) SDS
```
A) B-mercaptoethanol
125
What is the primary advantage of running a discontinuous protein gel with a stacking layer rather than a continuous gel?
A) proteins can be separated by size alone, rather tan being dependent on size, shape and charge
B) for better resolution of the protein bands
C) The gel runs faster
D) A and B
E) None of the above
B) for better resolution of the protein bands
126
What is the advantage of treating protein sample with SDS and B-mercaptoethanol?
A) Proteins can be separated by size alone, rather than being dependent on size, shape, and charge
B) For better resolution of the protein bands
C) The gel runs faster
D)A and B
E) none of the above
A) proteins can be separated by size alone, rather than being dependent on size, shape, and charge
127
T or F: the non-polymerized forms of acrylamide (powder and liquid) are far more dangerous than polymerized (solidified) polyacrylamid.
True
128
What should you be able to see on your blot after staining with Ponceau Red?
A) the molecular weight markers
B) only the specific GST:EGFP fusion protein
C) All of the proteins expressed by E. Coli in the lanes where you loaded cell lysates
D) A and B
E) A and C
E) A and C
129
When performing the Ponceau stain, you may see a band of approximately 25 kD in your negative control that is not present in your positive control of your other positive clones. What does this band likely represent?
The band represents GST protein alone as GST protein is 25 kDa
130
Upon developing the western blot from lab with a color metric substrate, what band swill you see on the membrane?
A) all bands stained by the Ponceau Stain
B) only the specific GST:EGFP fusion protein
C) all of the proteins expressed by E. Coli in the lanes where you loaded cell lysates
D) only the specific E. Coli proteins expressed after addition of IPTG
B) only the specific GST: EGFP fusion protein
131
What is the purpose of the GST portion of your fusion protein?
A) it makes the protein glow green
B) it is responsible for the IPTG induction of the protein
C) it allows for the affinity purification of the protein using glutathione affinity column
D) it allows the fusion protein to be cleaved into two fragments
C) it allows for the affinity purification of the protein using a glutathione affinity column
132
Where did the gst gene come from?
A)It was already engineered into the pET-41a expression vector
B) fluorescent jellyfish
C) we cloned it into the pET-41a expression vector after gel-purifying it.
D) b and c.
A) it was already engineered into the pET-41a expression vector
133
What fraction from an affinity chromatography purification experiment has the highest amount of protein of interest?
A) cell lysate
B) wash
C) eluate
cell lysate
134
Which fraction from an affinity chromatography purification experiment has the highest purity of the target protein?
A) cell lysate
B) wash
C) eluate
C) eluate
135
```
What methods were employed to lyse bacterial cells?
A) french press
B) sonication
C) freeze thaw
D) exposure to chloroform vapors
E) a and c
F) b and c
```
F) b and c
136
We need to use an EGFP-specific antibody in order to assess if we have successfully purified our fusion protein from contaminants. T or F
False
137
Additional bands in eluate fractions, i.e. other than the band representing the GST::EGFP fusion protein, could have resulted form:
A) contaminants present in your sample (column not washed well)
B) degradation of the fusion protein
C) Fusion proteins inability to bind to column
D)A and B
E) all of the above
D) a and B
138
How did we determine the concentrate of the fusion protein?
Fluorescence assay
139
```
Under de-repressed conditions, what does IPTG bind to induce gene expression on pET-41a?
A) The lac operator
B) LacI gene
C)LacZ gene
D)The promoter
E)LacI
```
E) LacI
140
```
Which of the following is NOT typically found on an expression vector?
A) screenable marker
B) selectable marker
C) promoter
D)ribosomal binding site
```
A) screenable marker
141
When performing a restriction digest, which of the following is true?
A) restriction enzyme buffers should be added to the reaction last
B)The final concentration of the enzyme buffer should be 10X
C) Multiple enzymes can be used in one reaction, as long as they are active in the same buffer
D) The volume of enzyme should exceed 10% of the total reaction volume
C) multiple enzymes can be used in one reaction, as long as they are active in the same buffer
142
```
Where does LacI bind to in order to repress expression of the GST:EGFP fusion protein in pET-41a?
A) lac operator
B) LacI gene
C) LacI protein
D) IPTG
```
A) lac operator
143
```
What does an A260/280 ratio less than 1.8 signify?
A) pure DNA
B) Single Stranded DNA
C) Protein Contamination
D) RNA contamination
```
Protein Contamination
144
```
Allie has a tube containing purified plasmid DNA at the contraption of 100 ng/uL. She needs to add 1 ug to a restriction digestion. What volume of her purified plasmid does she need to pippete?
A) .1uL
B) 1 uL
C) 10 uL
D) 100 uL
```
C) 10 uL
look at test 1 to see how to do it
145
```
Julie wants to clone an insert with NotI (GC/GGCCGC) ends into the multiple cloning site (MCS) of the vector pTREE. Which of the following enzymes (each present in the MCS) should be use to digest the vector?
A) Smal (CCC/GGG)
B) Eco521 ( C/GGCCG)
C) XmaI (C/CCGGG)
D) SacII (CGGC/CG
```
B) Eco52I
146
```
Jordan has desgned a cloning strategy that will insert his gene into the ScaI site of the pGEM-T easy vector. What result is he likely to see if he Transforms the products into E. Coli cells and plate them on medium with ampicillin, IPTG, and X-gal.
A) The appearance of all white colonies
B) The appearance of all blue colonies
C) The appearance of many colonies
D) The appearance of no colonies
```
D) The appearance of no colonies
147
Why is the Multiple cloning site present within the lacZ gene of the cloning vector pGEM-T easy?
A) enables growth in the presence of kanamycin
B) It allows the insert to be placed in frame with the lacZ promoter
C) Disruption of the lacZ gene allows blue/white selection of colonies
D) Cloning within the lacZ gene allows regulated expression by lacI
C) Disruption of the lacZ gene allows blue/white selection of clones
148
What is the purpose of glycerol in DNA loading buffer?
A) Intercalates into DNA and allows for UV visualization
B) Confers an overall net negative charge for DNA
C) Is a dye that helps visualize how far the sample has traveled in the gel
D) increases density of the sample so that it stays in the well
D) increases density of the sample so that it stays in the well
149
What factor would you consider when setting pu the annealing step of a PCR protocol?
A) melting temperature (Tm) of your primers
B) Length of template sequence
C) Template DNA concentration
D) the type of RNA polymerase being used
A) melting temperature (Tm) of your primers
150
```
The reverse primer:
A) binds to the sense strand
B)binds to the antisense strand
C) makes a copy of the antisense strand
D) is the reverse complement of the anti-sense strand
E) A and C
```
E) A and C
151
Gary performed a PCR using an annealing temperature of 69 degrees C to amplify a 700 bp product. Based on the Tm of the primers below, which of the following would he expect to see upon running an agarose gel of his PCR product.
Forward Primer: 5' GAGGATGGTCTCATGCACGG
Reverse Primer: 5' AACTGTTGTCAGATGACTTGA
A) Very little or no 700 bp product formed
B) a clear band at 700 bp
C) more 700 bp product formed than expected
D) Multiple, non-specific products formed
A) very little or no 700 Bp product formed
152
```
Which of the following is a unique feature of gene expression in eukaryotes:
A) promoter
B) Open Reading Frame
C) Introns
D) Ribosomal Landing site
```
C) introns
153
In DNA gel electrophoresis:
A) uncut plasmid DNA always runs slower than cut plasmid DNA of the same rise
B)DNA should be loaded into wells near the red(anode) lead
C) Large DNA molecules migrate through the gel more quickly than small DNA molecules
D)The percentage of agarose in a gel affects how far DNA molecules will migrate
D) the percentage of agarose in a gel affects how far DNA molecules will migrate
154
Phosphate treatment should be considered when:
A0 using a forced cloning strategy
B) using a blunt-ended cloning strategy
C) preparing your insert for ligation
D) You digest your vector with two restriction enzymes that leave incompatible ends
B) using a blunt ended cloning strategy
155
```
Which of the following is not true about transcription in Eukaryotes?
A) it takes place in the nucleus
B) It begins at the codon ATG
C) it requires DNA polymerase
D) B and C
```
D) B and C
156
```
You are interested in a protein obtained from a squid involved in neurological control of skin camouflage. You want to know if proteins have been identified in other organisms with similar amino acid sequences. Which program would you use to search for matches using an amino acid sequence as the query?
A) Genbank
B) blastx
C) nucleotide blast
D) protein blast
```
D) protein blast
157
in SDS-page, which component of the loading buffer is correctly matched with its function in preparing the sample for electrophoresis?
A) SDS- denatures protein structure
B) B- mercaptoethanol-disrupts non-covalent bonds
C) Glycerol- coats proteins in a uniform negative charge
D) Color Dye- provides ions critical for electrophoresis
A) SDS- denatures protein structure
158
What does the E value of a BLAST sequence match indicate?
A) the percent of nucleotides that are similar between the query and the subject sequence
B)The likelihood that the sequence match occurred by random chance
C)The number of similar sequences found in the NCBI database
D)The number of organisms that have sequences similar to the query
B) the likelihood that the sequence match occurred by random chance
159
```
In your research lab, you work on an unusual model organism, the naked mole rat. Specifically your research focuses on the function of the Akt gene ( an intracellular signaling molecule) in naked mole rat cells. You want to find the DNA sequence for Akt in this organism but cannot find a corresponding Refseq file. What database should you turn to next?
A) Protein blast (blastp)
B) NEB cutter
C) Pubmed
D) Genbank
```
D) genbank
160
```
In affinity purification, the sample with the highest total amount of protein of interest is:
A) Wash fraction
B)Elution Fraction
C) Crude HOmogenate
D) None of the above
```
C) Crude HOmogenate
161
```
You have purified a single protein from cultured insect cell that you think has therapeutic potential for treating liver disease. You eluted your protein with a buffered wash solution (i.e. no detergent). Which protein assay would be best to determine the concentration of the protein of interest in your preparation?
A) Bradford
B) Lowry
C) BCA
D) None of the above
```
A) bradford
162
You have a 600 nucleotide DNA coding sequence. If the coding sequence is transcribed and translated what is the estimated molecular weight of the resulting protein? ( assume one amino acid= 114 Da)
22.8 kDA
163
Natalie digests a 4.0 kb plasmid with pstI, which has two restriction sites: one at 1000bp and the second at 3000 bp. What would she expect to see on the gel? (ASSUME: PstI does not have any star activity and that her digestion went to completion)
A) a single band with unpredictable size
B) A single Band at 2kb
C) Two bands (1kb and 3kb bands)
D) Multiple bands with unpredictable size
B) a single band at 2kb
164
```
Which of the following cannot be confirmed by performing a PCR screen using two primers that bind to the insert sequence?
A) the orientation of the insert
B) the reading frame of the insert
C) the sequence of the insert
D) all of the above
```
D) ALL OF THE ABOVE
165
When performing a PCR screen, which of the following is truer about the melting temperature (Tm) of your primers?
A) The Tm of both primers should be within 5 degrees C of each other
B)The Tm should not exceed 55 degrees C
C) The Tm of the forward and reverse primers should be 5 degrees lower than the annealing temperature of the PCR reaction
D) The Tm of the primers will depend on the length of the insert
A) the Tm of both primers should be within 5 degrees C of each other
166
Dave performed a western blot to detect GST:EGFP from E. Coli expressing the fusion protein. He used a polyclonal chicken anti-EGFP primary antibody and then a chicken anti-rabit secondary antibody. What would ou expect to see on his blot?
A) multiple bands representing all of the proteins in the E. Coli cell lysate
B) A specific GST:EGFP band
C)no specific GST::EGFP band
D) and and B
C) no specific GST:EGFP bands
167
You perform a ligation with NcoI/NotI-digested pET-41a vector and the egfp insert. you then transform the ligation mix into E. Coli and plate on LB medium containing kanamycin. You observe many colonies, but upon screeing 20 of them you only observed pET-41a. Which is possible reason for this outcome?
A) the ligase was inactive
B) one or both of the restriction enzymes were inactive
C)The E. Coli cells were not competent
D) The kanamycin was bad
B) one or both of the restriction enzymes were inactive
168
Which region of the primary antibody recognizes and binds an antigen?
Variable region
169
What is the advantage of using a discontinuous SDS-PAGE gel rather than a continuous SDS-Page gel?
A) To keep proteins denatured during electrophoresis
B) To increase resolution of bands
C) to increase the speed at which the gel runs
D) To ensure the gel at a constant speed, allowing you to accurately determine sizes of bands
B) to increase resolution of bands
170
```
What is the ligand on the resin that you will pack your column with to purify your GST:EGFP fusion protein?
A) Nickel
B) Glutathione
C)GST
D)lactose
```
B) glutathione
171
Which of the following screening techniques gives information about the orientation of the insert?
A) SDS-Page followed by coomassie stain of the gel
B) Non-anchored PCR screen where both primers anneal to the insert
C) Sanger sequencing of the vector: insert junction
D) all of the above
C) sanger sequencing of the vector:insert junction
172
```
Which of the following components of SDS-Page loading buffer confers a net negative charge on proteins in the sample?
A) SDS
B)Bromophenol Blue
C) Glycerol
D) B- Mercaptoethanol
```
A) SDS
173
```
When performing affinity chromatography, the _____ while have the least concentrated amount of your protein of interest?
A) crude homogenate (lysate)
B)Wash fraction
C) First elution fraction
D) Last elution fraction
```
B) Wash fraction
174
```
Where do you NOT expect to see multiple N's within a sequence result obtained by Sanger Sequencing?
A) at the beginning of your sequence
B) At the end of your sequence
C) In the middle of your sequence
D) all of the above
```
C) in the middle of your sequence
175
In which of the cases below, would you need to use non-specific staining (geocode Blue or similar) rather than a specific method (western blot)
A) observing overall protein expression (of all proteins in the cell)
B) observing mRNA levels in the cell
C) detecting expression of only your fusion protein
D) A and C
A) observing overall protein expression (of all proteins) in the cell
176
```
Your friend Lola developed her membrane after western blotting and it is blank (no bands). She mentions that she did not see any bands on her blot after Ponceau Stain prior to blocking her membrane> what step in the western blotting procedure most likely went wrong to account for these results?
A) transfer
B) Primary antibody incubation
C) Enzyme Substrate
D) Secondary Antibody Incubation
```
A) transfer
