finals (I'M BACK ON BRAINSCAPE) Flashcards

Question

What is a hemorrhagic stroke and why is it dangerous?

Answer 1

1. if arteries penetrate brain tissue, they can rupture and cause bleeding 2. cerebral artery aneurysms can be the cause of subarachnoid bleeding 3. small arteries bleed and rupture into brain tissue

Answer 2

1. literally the only difference is that with TIAs, if the blockage dissolves, blood flow resumes

Answer 3

1. radiopaque dye is injected to determine if there is narrowing or a blockage in the right coronary artery 2. the balloon catheter is inserted over the guide wire and it’s put in the correct position 3. the balloon is inflated, which then crushes the plaque to resume the bloodstream

Answer 4

1. after an angioplasty the balloon is reinflated to use the stent 2. drug eluting stents have a polymer coating them that releases drugs which prevents the artery from narrowing again

Answer 5

- it creates new passages for the blood to flow to your heart muscle - it takes blood vessels from other parts of your body, called grafts, and it uses those blood vessels to reroute clogged arteries

Answer 6

they trap foreign particles from the air and push them to the throat so they don’t enter the lungs

Answer 7

epiglottis

Answer 8

- they’re in the larynx - testosterone thickens them, which lowers a person’s voice

Answer 9

a flat muscle below the lungs

Answer 10

- airways get infected, causing mucus creation and coughing - inflammation also occurs

Answer 11

- alveoli break down, resulting in less surface area than is needed for gas exchange with capillaries on the alveoli

Answer 12

Nucleotides are linked together by bonds between phosphate groups and deoxyribose sugars (sides of molecule) phosphates are the ladder backbones of the DNA

Answer 13

* each strand has a 5' end and a 3' end * the two strands run in opposite directions * The 5 and 3 refer to the carbon atoms on the deoxyribose sugar

Answer 14

1. two strands are separated by an enzyme called **helicase**, resulting in the formation of a replication fork 2. each strand provides a template for creating a new strand of DNA 3. an enzyme called primase starts the process, making a small piece of RNA called a primer 4. an enzyme called **DNA polymerase** binds to the primer and makes a new strand of DNA 5. it can only add bases in one direction: from the 5' end to the 3' end 6. one of the new strands, a leading strand, is made continuously, from 5' to 3' 7. the lagging strand can't be made continuously because it's made in the opposite direction, from 3' to 5' 8. **DNA polymerase** can only make the lagging strand in a series of small chunks known as Okazaki fragments 9. each fragment is started by an RNA primer 10. **DNA polymerase** then adds a short row of RNA bases in the 5' to 3' direction 11. the next primer is added further down the lagging strand 12. another Okazaki fragment is made and the process repeats 13. once the DNA is made, the enzyme exonuclease removes all RNA primers from the new strands of DNA 14. **DNA polymerase** fills in the gaps left behind w/DNA 15. enzyme DNA ligase seals up DNA fragments in both strands to form a continuous double strand

Answer 15

* A and T have 2 hydrogen bonds * G and C have 3 hydrogen bonds

Answer 16

**first phase** 1. phage was produced in a medium that also contained S-35 amino acids 2. this led to a phage population with S-35 labeled proteins, but no label in DNA 3. phage infected the bacteria by attaching to the outside of the cell and injected the DNA into the cell, but the protein coat stayed on the outside of the cell 4. phage in these cells were not radioactive 5. when intense shaking occurred, protein coat shook off, but phage production in the cell was unaffected **second phase** 6. phage were produced in a medium that had P-32 nucleotides 7. this led to a population with P-32 labeled nucleotides, but no label in the protein 8. when the phage infected the bacteria, radioactive DNA entered the cell and was found in phage that was later produced in the bacteria

Answer 17

* it damages cancer cells * interferes with uncontrolled cell division

Answer 18

G1 | mitosis is also affected a bit though ## Footnote it can also cause DNA errors during synthesis and if apoptosis doesn't occur DNA damage can spread, causing tumors

Answer 19

half of the original molecule is already there to serve as a template for the new strand

Answer 20

* often have at least 60 mutations * they take nutrients from healthy cells * they can't perform the tasks that healthy cells need to do * they crowd out healthy cells * does not have much apoptosis (cell suicide) * **uncontrolled growth of abnormal cells** * shortens the cell cycle and affects gap1 and mitosis the most * since the cell cycle is shortened, doctors have to act quickly

Answer 21

when cancer cells release chemicals that cause bloood vessels to grow towards the tumor to supply it with nutrients and allow it to metastasize (spread

Answer 22

**benign** * confined to one area; slow growing * stage 0 tumors are benign **malignant** * can spread to other areas; fast growing * stages I, II, III, and IV tumors are malignant

Answer 23

indentation in the cell membrane of an animal cell during cytokinesis

Answer 24

new cell wall formed during a plant cell's cytokinesis

Answer 25

**prophase** * nuclear membrane breaks down * spindle fibers made of microtubules begin to lengthen as centrioles move apart * chromatin coils into visible chromosomes **metaphase** * spindle fibers are attached to the centromeres of the chromatids * chromosomes are pulled to the equator (or middle) of the cell) * nucleus is gone btw **anaphase** * sister chromatids of duplicated chromosomes are pulled apart as spindle fibers shorten and move to opposite ends of the cell **telophase** * new nucleus forms around each set of chromosomes * cell membrane pinches inward at center * chromosomes unwind into chromatin * spindle fibers break down **cytokinesis** * division of the cytoplasm

Answer 26

**gap1** (11 hrs) * cell grows bigger and functions normally * has checkpoints (is the cell big enough? are there enough energy and other reserves? is the DNA damaged?) **gap0** * cell stops dividing * happens to damaged cells to ensure the damage doesn't spread * goes into this phase during G1 **synthesis** (8 hrs) * cell copies DNA **gap2** (4 hrs) * cell makes more organelles and proteins for division * has checkpoints (did all our DNA get replicated together? is the DNA damaged?) **mitosis** (1 hr) * cell divides duplicated chromosomes/DNA evenly * cell divides cytoplasm and organelles (cytokinesis)

Answer 27

* Cells that give rise to all of the cells in the body * Stem cells can divide to create many different types of cells in the body (or to make new stem cells) * When stem cells become a particular specialized type of cell (like a white blood cell, for example), they are said to have differentiated

Answer 28

* The cell’s interior grows at a faster rate than the plasma membrane * At a certain point, membrane transport cannot supply the needs of the cell (nutrient uptake, excretion of waste, etc.) * Cells must stay small to remain efficient

Answer 29

**proto-oncogenes** * start cell division **tumor suppressor genes** * stop cell division * p53 is a tumor suppressor gene (mutated in more than half of all cancers) * it activates DNA repair (stops cell cycle from G1 going into S phase) * It initiates apoptosis (cell self-destruction) if DNA damage is too much to fix ## Footnote When both types of genes are mutated in the same cell, the cell can divide out of control

Answer 30

* during mitosis the cell splits, but in this single cell, there are many nuclei, indicating that **mitosis** was skipped

Answer 31

* it stops cell division and therefore contains cancerous cells * cells that divide rapidly are targeted by chemo, so that explains the side effects

Answer 32

1. Transcription factors assemble at a specific promoter region along the DNA. 2. The length of DNA following the promoter is a gene and it contains the recipe for a protein. 3. A mediator protein complex arrives carrying the enzyme **RNA polymerase.** 4. It manoeuvres the **RNA polymerase** into place... inserting it with the help of other factors between the strands of the DNA double helix. 5. The assembled collection of all these factors is referred to as the transcription initiation complex... and now it is ready to be activated. 6. The initiation complex requires contact with activator proteins, which bind to specific sequences of DNA known as enhancer regions (These regions may be thousands of base pairs distant from the start of the gene.) 7. Contact between the activator proteins and the initiation-complex releases the copying mechanisM. 8. The **RNA polymerase** unzips a small portion of the DNA helix exposing the bases on each strand. 9. Only one of the strands is copied. 10. It acts as a template for the synthesis of an RNA molecule which is assembled one sub-unit at a time by matching the DNA letter code on the template strand. 11. The sub-units can be seen here entering the enzyme through its intake hole and they are joined together to form the long messenger RNA chain snaking out of the top.

Answer 33

1. As DNA is transcribed into RNA it needs to be edited to remove non-coding regions, or introns, shown in green. 2. This editing process is called splicing, which involves removing the introns, leaving only the yellow, protein-coding regions, called exons.. 3. RNA splicing begins with assembly of helper proteins at the intron/exon borders. 4. These splicing factors act as beacons to guide small nuclear ribo proteins to form a splicing machine, called the spliceosome. 5. The spliceosome then brings the exons on either side of the intron very close together, ready to be cut. 6. One end of the intron is cut and folded back on itself to join and form a loop 7. The spliceosome then cuts the RNA to release the loop and join the two exons together. 8. The edited RNA and intron are released and the spliceosome disassembles.

Answer 34

Exons from the same gene can be spliced together in different combinations to make different proteins

Answer 35

1. the **ribosome** is composed of one large and one small sub-unit that assemble around the **mRNA**, which then passes through the **ribosome** like a computer tape. 2. The amino acid building blocks are carried into the **ribosome** attached to specific **tRNAs**. 3. The small sub-unit of the **ribosome** positions the **mRNA** so that it can be read in groups of three letters known as a **codon**. 4. Each **codon** on the **mRNA** matches a corresponding **anti-codon** on the base of a **tRNA** molecule. 5. The larger sub-unit of the **ribosome** removes each amino acid and join it onto the growing protein chain. 6. As the **mRNA** is ratcheted through the **ribosome**, the **mRNA** sequence is translated into an amino acid sequence. 7. There are three locations inside the **ribosome**, designated the A-site, the P-site and the E-site. 8. The addition of each amino acid is a three step cycle: First, the **tRNA** enters the **ribosome** at the A-site and is tested for a **codon/anti-codon** match with the **mRNA**. 9. Next, provided there is a correct match, the **tRNA** is shifted to the P-site and the amino acid it carries is added to the end of the amino acid chain. 10. The **mRNA** is also ratcheted on three nucleotides or one **codon**. 11. Thirdly, the spent **tRNA** is moved to the E-site and then ejected from the **ribosome** to be recycled. 12. As the protein synthesis proceeds, the finished chain emerges from the **ribosome**. 13. It folds up into a precise shape, determined by the exact order of amino acids. ## Footnote review

Answer 36

1. AUGCGUGUAAAUGCAUGCGCC 2. Met Arg Val Asn Ala Cys Ala 3. it would be TCA, transcribed to AGU instead. Met **Ser** Val Asn Ala Cys Ala. A different protein would be formed. The mRNA code is changed and therefore changes the tRNA code and that changes the protein and therefore changes the function it carries out.

Answer 37

* substitution: 1 base is changed * missense substitution: one base is changed so it codes for another amino acid * silent substitution: they don't change the protein that is coded for by a gene * nonsense substitution: changes the codon for an amino acid to a stop codon * deletion/insertion: self explanatory tbh. but it changes ALL the codons after the mutation

Answer 38

* generates the gametes for reproduction * happens in germ cells in the testes (AMAB) or in the ovaries (AFAB) * produces haploid cells * from each diploid germ cell, meiosis produces 4 genetically different haploid cells

Answer 39

* 1 chromosome in each pair comes from each parent * they're similar in size, shape, and the type of genes they contain * each chromosome could have different variations of the same type of genes

Answer 40

* haploid cells have half the normal number of chromosomes - just one from each homologous pair

Answer 41

* homologous chromosomes exchange genetic info forming new combos of genes * mutations in gametes change the genetic info that will be passed onto offspring * since each chromosome is randomly distributed during meiosis, each kid could get different combos of chromosomes from their parents ## Footnote homologous chromosomes exchange genetic information forming new combinations of genes (see diagram) Mutations in gametes (NOT somatic cells) change the genetic information that will be passed on to the offspring

Answer 42

* every gene comes in different variations called alleles * most genes have 2 different alleles that exist in a population * 1 person can have no more than 2 different alleles for the same gene **(we get 1 allele from each parent)**

Answer 43

* nitrogen base (make up the "rungs of the ladder") * phosphate * deoxyribose (sugar) * sugar and phosphate make up the sides/backbone of the ladder * nucleotides are linked together by bonds between phosphate groups and deoxyribose sugars (sides of molecule)

Answer 44

* adenine (A) and thymine (T) are always paired together with 2 hydrogen bonds, as are cytosine (C) and guanine (G), which are held together by 3 hydrogen bonds * A:T=C:G

Answer 45

* stem cells are involved in regenerating and replacing cells throughout the body (blood, bone, skin, muscle, etc.) * cells that give rise to all of the cells in the body * stem cells can divide to create many different types of cells in the body or to make new stem cells

Answer 46

* **G1 (11 hrs)** 1. cell grows bigger and functions normally 2. has checkpoints (is the cell big enough? are there enough energy and other reserves? is the DNA damaged?) **S (8 hrs)** 1. DNA replication occurs (I describe that in another flashcard. I'm not doing it again here.) **G2 (4 hrs)** 1. cell makes more organelles and proteins for division 2. has checkpoints (did all our DNA get replicated together? is the DNA damaged?) **mitosis (1 hr)** 1. cell division occurs in the following phases: 2. prophase 2. metaphase 3. anaphase 4. telophase **cytokinesis** cell divides cytoplasm and organelles

Answer 47

**prophase** 1. nuclear membrane breaks down 2. spindle fibers made of microtubes begin to lengthen as centrioles move apart 3. chromatin coils into visible chromosomes **metaphase** 1. spindle fibers are attached to the centromeres of the chromatids 2. chromosomes are pulled to the equator (or the middle of the cell) 3. nucleus is gone btw **anaphase** 1. sister chromatids of duplicated chromosomes are pulled apart as spindle fibers shorten and move to opposite ends of the cell **telophase** 1. new nucleus forms around each set of chromosomes 2. cell membrane pinches inward at center 3. chromosomes unwind into chromatin 4. spindle fibers break down

Answer 48

- with plant cells it's different bc a cell plate forms for a new cell wall - with animal cells a cleavage furrow forms (indentation in the cell membrane)

Answer 49

the uncontrolled growth of abnormal cells in the body * cancer cells can secrete a growth hormone that makes blood vessels divert over to those cancer cells and supply the cancer cells with nutrients, which can take nutrients away from healthy cells (this is angiogenesis) * this allows it to metastasize and spread * they don't respond to normal cell signals * most cancer cells have at least 60 mutations * cancer shortens the cell cycle, meaning doctors have to act quickly

Answer 50

**proto-oncogenes** * accelerate (start) cell division * when proto-oncogenes are mutated, they become hyperactive and produce cells that respond too much to growth promoting genes **tumor suppressor genes** * stop cell division * in the case of p53, a tumor suppressor gene that is mutated in over 1/2 of all cancers, it activates DNA repair (stops cell cycle from G1 going into S phase) * it also initiates apoptosis (cell suicide) if DNA damage is too much to fix * if mutated, they get deactivated when both genes are mutated in the same cell, they can lead to uncontrollable cell division

Answer 51

G1 and mitosis

Answer 52

1. it affects G1 and also f%cks up synthesis bc it causes mutations and errors 2. damaged cells can keep dividing and the damaged DNA could spread

Answer 53

* a phase in which a cell is not preparing to divide * a cell can go into G0 during G1 * cells can enter G0 if they're damaged to ensure that the damage doesn't spread * if their cells don't go through apoptosis, tumors could form

Answer 54

* it damages cancer cells and also messes with the cell division

Answer 55

* mitosis because that's when the cell splits and this thing is not doing that

Answer 56

it kills rapidly-dividing cells, which leads to some side effects such as hair loss and nausea

Answer 57

to prove that DNA carried genetic information

Answer 58

a bacterial virus (DNA molecule coated in protein)

Answer 59

**phase i** 1. phage was produced in a medium which also had S-35 amino acids 2. this led to a phage population with S-35 labeled proteins, but no label in DNA 3. the phage then infected the bacteria by attaching to the outside of the cell and injecting the DNA into the cell, but the protein coat stayed on the outside of the cell 4. the phage in these cells weren't radioactive 5. when intense shaking occurred, the protein coat was removed, but it didn't affect phage production within the cell **phase ii** 1. phage were produced in a medium which had P-32 nucleotides 2. this led to a phage population with P-32 labeled nucleotides, but no label in the proteins 3. when the phage infected the bacteria, radioactive DNA entered the cell and was found in phage that was later produced in the bacteria

Answer 60

non cancerous

Answer 61

cancerous, growing uncontrollably

Answer 62

cell death/cancerous growth

Answer 63

* the complete set of genetic instructions (DNA sequence) in humans * it's important bc it lets us know what amino acids we have

Answer 64

1. transcription factors assemble at a specific promoter region along the DNA 2. the length of DNA following the promoter is a gene and it contains the recipe for a protein 3. a mediator protein complex arrives carrying the enzyme **RNA polymerase** 4. it manoeuvres the **RNA polymerase** into place, inserting it with the help of other factors between the strands of the DNA double helix 5. the assembled collection of all these factors is referred to as the transcription initiation complex and now it's ready to be activated 6. the initiation complex requires contact with activator proteins, which bind to specific sequences of DNA known as enhancer regions (these regions may be thousands of base pairs distant from the start of the gene) 7. contact between the activator proteins and the initiation-complex releases the copying mechanism 8. the **RNA polymerase** unzips a small portion of the DNA helix exposing the bases on each strand 9. only one of the strands is copied 10. it acts as a template for the synthesis of an RNA molecule which is assembled one sub-unit at a time by matching the DNA leter code on the template strand 11. the sub-units can be seen entering the enzyme through its intake hole and they're joined together to form the long messenger RNA chain snaking out of the top

Answer 65

1. RNA splicing begins with assembly of helper proteins at the intron/exon borders 2. these splicing factors act as beacons to guide small nuclear ribo proteins to form a splicing machine, called the spliceosome 3. the spliceosome then brings the exons on either side of the intron very close together, ready to be cut 4. 1 end of the intron is cut and folded back on itself to join and form a loop 5. the spliceosome then cuts the RNA to release the loop and join the 2 exons together 6. the edited RNA and intron are released and the spliceosome disassembles

Answer 66

exons from the same gene can be spliced together in different combos to make different proteins

Answer 67

1. the **ribosome** is composed of one big and one small sub unit that assemble around the **mRNA** which then passes through the **ribosome** like a computer tape 2. the amino acid building blocks are carried into the **ribosome** attached to specific **tRNAs** 3. the small sub-unit of the **ribosome** positions the **mRNA** so that it can be read in groups of 3 letters (a **codon**) 4. each **codon** on the **mRNA** matches a corresponding **anti-codon** on the base of a **tRNA** molecule 5. the bigger sub-unit of the **ribosome** removes each amino acid and joins in onto the growing protein chain 6. as the **mRNA** is ratcheted through the **ribosome**, the **mRNA** sequence is translated into an amino acid sequence 7. there are three locations inside the **ribosome** (the A-site, the P-site, and the E-site) 8. the **tRNA** enters the **ribosome** at the A-site and is tested for a **codon/anti-codon** match with the **mRNA** 9. if there's a correct match, the **tRNA** is shifted to the P-site and the amino acid it carries is added to the end of the amino acid chain 10. the **mRNA** is also ratcheted on 3 nucleotiddes or one **codon** 11. the spent **tRNA** is moved to the E-site and then ejected from the **ribosome** to be recycled 12. as protein synthesis proceeds, the finished chain emerges from the **ribosome** 13. it folds up into a precise shape, determined by the exact order of amino acids

Answer 68

* AUGCGUGUAAAUGCAUGCGCC * MetArgValAsnAlaCysAla * it might change the amino acid produced, causing substitution, which would change the shape of the protein, which would change the way the person is affected by the protein

Answer 69

* Every gene comes in different variations called alleles (uh-leels) * Most genes have two different alleles that exist in a population (some genes have multiple alleles) * One person can have no more than two different alleles for the same gene **(we get one allele from each parent)**

Answer 70

* One chromosome in each pair comes from each parent * They are similar in size, shape, and the type of genes they contain (* Each chromosome could have different variations of the same type of genes

Answer 71

* Cell division that forms gametes (sex cells - sperm and egg) * Happens in germ cells in the testes (males) and ovaries (females) * Produces haploid cells (cells with half the normal number of chromosomes - just one from each homologous pair) from diploid germ cells * From each diploid germ cell, meiosis produces **4 genetically different haploid cells ** * for meiosis to occur, chromosomes must be correctly sorted and distributed in a manner to create genetically unique cells with half the # of chromosomes as the OG cell * for the successful reduction in the # of chromosomes to occur in the new haploid daughter cells, 2 rounds of division are needed (meiosis i and meiosis ii) **meiosis i** 1. meiosis begins after the cell has successfully completed interphase 2. during synthesis, DNA replicated, producing 2 copies of each chromosome called sister chromatids 3. the paired centrioles in the cytoplasm duplicate and begin extending microtubules that will form the meiotic spindle 4. sister chromatids stay attached at the centromere and condense as the cell enters.... **prophase i (beginning of meiosis i)** 1. rn it looks pretty similar to mitosis 2. homologous pairs of sister chromatids lie side by side in a process called synapses forming a tetrad/bivalent (same thing) 3. the homologous chromosomes share similar but not necessarily identical genes 4. once this structure's formed, crossing over can occur 5. during crossing over, a physical exchange between chromosome segments of non sister chromatids occurs, increasing genetic diversity 6. nuclear envelope disintegrates as the duplicated centriole pairs move to opposite poles of the cell 7. as they move, the centrioles extend spindle fibers, forming the meiotic spindle **prometaphase i** 1. with the paired centrioles in place, the meiotic spindle is fully formed 2. the sister chromatids attached to the spindle fibers by their kinetochores 3. because of synapses and crossing over in meiosis, homologous chromosomes stay aligned so that a pair of sister chromatids is attached to only 1 pole by the kinetochore microtubules **metaphase i** 1. tetrads/bivalents randomly align along the metaphase plate 2. due to independent assortment, this alignment is random and adds to genetic diversity **anaphase i** 1. the homologous chromosomes separate and move towards opposite poles **telophase i** 1. the chromosomes decondense and the nuclear envelope reforms **cytokinesis (end of meiosis i)** 1. separates the plasmic material and a cleavage furrow separates the 2 daughter cells **meiosis ii** 1. meiosis ii begins without the chromosomes going through another round of synthesis 2. centrioles again duplicate and move to opposite poles of each cell **prophase ii** 1. sister chromatids start condensing while spindle starts forming as the nuclear envelope disappears **prometaphase ii** 1. the sister chromatids attached to the spindle by kinetochore microtubules with sister chromatids attached to opposite poles **metaphase ii** 1. the spindle aligns the sister chromatids along the metaphase plate **anaphase ii** 1. sister chromatids separate and individual chromosomes move toward the poles **telophase ii** 1. chromosomes decondense and nuclear envelope reforms **cytokinesis ii** 1. cytokinesis occurs and cleavage furrows separate the 2 daughter cells into **4 haploid daughter cells** 2. the haploid cells will specialize as gametes, either egg or sperm depending on the sex of the human 3. these will join during fertilization, which will form a zygote that will become an offspring, which has half its chromosomes from each parent

Answer 72

* Genetic recombination (crossing over) - homologous chromosomes exchange genetic information forming new combinations of genes (see diagram) * Mutations in gametes (NOT somatic cells) change the genetic information that will be passed on to the offspring ## Footnote Since each chromosome is randomly distributed during meiosis, each child could get different combinations of chromosomes from their parents

Answer 73

**genes** * genes determine the traits of an organism * there may be a few hundred to over a thousand genes on a chromosome **chromosome** * coiled up DNA wrapped around proteins called histones * humans have 46 chromosomes * DNA is only in this form during mitosis

Answer 74

situation in which 1 allele isn't completely dominant over another and thus heterozygotes display a phenotype **in between** that of the two homozygous parental varieties | ex. red and white petunias give rise to pink petunias ## Footnote different letters are used in genetics problems in which incomplete dominance is displayed

Answer 75

situation in which both alleles of genes contribute to the organism and thus heterozygotes display a phenotype that includes traits of both alleles simultaneously ## Footnote * ex. red and white cattle give rise to calves with roan coloring (red and white patches) * in genetics problems with codominance, two different capital letters are used as superscripts to a common letter (ex. C^R, C^W)

Answer 76

the chance or likelihood of an event occurring

Answer 77

a diagram used to show the inheritance of a trait in a family

Answer 78

an individual who has 1 copy of the allele for a recessive trait | (heterozygote)

Answer 79

an individual who displays a given phenotpe

Answer 80

when one gene affects many characteristics | ex. sickle cell anemia

Answer 81

when many genes affect a single characteristc | ex. skin color

Answer 82

a disorder caused by recessive alleles that results in excess mucus in the lungs, digestive tracts, and liver as well as icreased susceptibility to infection

Answer 83

a condition caused by recessive alleles in which the affected individual lacks pigment in their skin, hair, and eyes

Answer 84

* a condition in which affected individuals can't break down the amino acid phenylalanine * results in accumulation of phenylalanine in tissues * lack of normal skin pigment * intellectual disability * caused by recessive alleles

Answer 85

* caused by recessive alleles * results in nervous system breakdown due to lipid accumilation in brain cells * mental deficiency * blindness * death in early childhood

Answer 86

* caused by codominant alleles * results in misshapen or "sicked" red blood cells * damge to many tissues is possible

Answer 87

* form of dwarfism * caused by a dominant allele

Answer 88

a disease which causes progressive deterioration of the nervous system (starting in middle-age/40s) and results in loss of muscle control, mental deterioration & eventually death | caused by a dominant allele

Answer 89

when there are more than 2 alleles for a particular gene ## Footnote ex. human ABO blood type, coat color in rabbits

Answer 90

American geneticist whose study with fruit flies led him to discover sex-linked inheritance

Answer 91

the common fruit fly, ideal for genetic experiments due to its small size, easily observable characteristics, and large brood size (# of offspring born in 1 reproductive cycle)

Answer 92

non-sex chromosomes, chromosomes that carry genes that don't involve sex determination

Answer 93

chromosomes that carry genes which determine gender | the X and Y chromosomes in humans

Answer 94

causes affected individual to bleed excessively when injured due to inability of blood to clot

Answer 95

malfunction of light receptors in eyes such that individual can detect fewer colors than normal--individual can't determine between red and green colors especially

Answer 96

characterized by progressive muscular deterioration, leading to loss of strength and eventual death

Answer 97

* a gradual change in the genes of a population over time

Answer 98

* a well tested explanation of observable events supported by experimental evidence collected over time * variation exists between individuals in any population * organisms compete with each other for survival * individuals with adaptations best suited for their environment survive, reproduce, and pass on their traits via their genes (natural selection) * all species share a common ancestor with each other (descent) * all species change over time due to natural selection (modification)

Answer 99

* evolution happens to a population over generations, not a single individual * a single organism's genes can't be changed

Answer 100

* stabilizing: average phenotype is favored * directional: favors 1 of the extreme phenotypes * disruptive: favors both extreme phenotypes

Answer 101

**fossil record** * shows anatomical changes in a species over time * transitional fossils show how one species may have given rise to another **homologous and vestigial structures** * homologous structures: structures with the similar design in different species but serve a different purpose (ex. human arm, cat leg, whale flipper) * similarities in the structures suggest that the organisms shared a common ancestor that also had these structures * vestigial structures: a structure that's present in an organism but no longer serves its original purpose (ex. ear wiggling muscles, sperm whale hip bones) **comparative embryology** * early stages of development of many species have a similar appearance/structure * the genes for early development of embryos are highly conserved (are the same or similar in many species) **genetic/molecular comparisons** * similarities in the genes and proteins of different species * closely related organisms share a high percentage of similarity in their DNA * these similarities can be used to construct evolutionary relationships

Answer 102

* Hox genes determine the layout of the body (ex. the placement and structure of the arms and legs) * mutations to any Hox gene can alter the body of an organism significantly * these changes are reflected in the changes in species that we see in the fossil record

Answer 103

* cladograms show evolutionary relationships between different species * the more closely the species are related to each other, the closer they are to each other * DNA and amino acid sequences can be used to help construct a cladogram (more clsoely related species have less differences in the amino acid sequences for the same protein)

Answer 104

* gene pool is all the genes in a population of a species * evolution's caused by changes in the gene pool of a population over time * the frequency of an allele in the gene pool is known as allelic frequency * factors that can change a gene pool over time: mutations, natural selection, gene flow (movement of genes into or out of the gene pool), genetic drift (changes in allelic frequency due to random events, ex. a human foot squishing bugs)

Answer 105

**mutations** **natural selection** **gene flow** * movement of genes into or out of the gene pool **genetic drift** * changes in allelic frequency due to random events, ex. a human foot squishing bugs * bottleneck effect (pov. zombie apocalypse. some of us have immunity to zombies. the rest don't. those who have immunity live and those who don't die) * founder effect (when a group of a population physically breaks away

Answer 106

**members of a population become isolated from each other** * a magical barrier is placed between a population of unicorns. **each new population evolves through natural selection with no gene flow between populations** * over time, one of the groups develops silver horns while the other develops gold horns. they don't interbreed **over time, the gene pool of each population changes due to natural selection and genetic drift** * self explanatory tbh. gene pool changes. genome changes. **when members from the 2 populations can't successfuly reproduce with each other, they're considered different species** * this could be because the barrier is still up or because if they reproduce it'll be reproductively isolated

Answer 107

**sympiatric speciation** * The evolution of a new species from a surviving ancestral species while both continue to inhabit the same geographic region * the evolution of a new species from a surviving ancestral species while both continue to inhabit the same geographic region * this can be behavioral isolation/temporal isolation/reproductive isolation **allopatric speciation** * a geographic barrier stops them from interbreeding and sharing the same gene pool * eventually, there can be change over time in the separated populations in their separated areas from mechanisms like natural selection or genetic drift * over time these populations can have significant genetic differences that might not allow them to interbreed even if they were brought together * populations separated geographically can form different species

Answer 108

* geographic isolation: a natural barrier stops two groups from interbreeding * temporal isolation: different mating seasns stop individuals from interbreeding * behavioral isolation: different behaviors stops two groups from interbreeding ## Footnote as a result of the above, reproductive isolation develops between different populations

Answer 109

* there's basically more genetic diversity since it's 2 gene sets instead of 1 gene set so there's like so many more possibilities * there's stuff like crossing over and independent assortment that just creates variety during sexual reproduction that is absent during asexual reproductions sooooooooooooooooooo * also mutations are great for natural selection because of how they increase genetic diversity and that's just like really great for everyone involved like

Answer 110

* a bunch of bacteria, including a resistant variety get bathed in antibiotics * for context, this resistant variety has random mutations that allow for resistance * most of the normal bacteria die * the resistant bacteria multiply and become more common * eventually, the entire infection evolves into a resistant strain

Answer 111

**habitat** * where an organism lives **niche** * an organism's role in an ecosystem - its habitat + what it eats and what eats it * if the niches of two different species overlap, competition occurs * like hyenas have beef with lions because they live in the same habitat and like have similar prey and their niches overlap * but like hyenas don't have beef with blades of grass because they don't even share the same prey (the grass doesn't have prey to begin with because it's a producer but we'll get to that later)

Answer 112

**producer/autotroph** * organism that makes its own energy/food * autotrophs (photosynthetic) * ex. plants, some bacteria **consumer/heterotroph** * organism that must eat another organism to obtain energy * ex. animals, fungi, some bacteria **decomposer** * break down dead matter for their food * ex. fungi, some insects, bacteria

Answer 113

* pyramids of energy show the energy stored in the bodies of all the organisms in each trophic level * pyramids of energy always are widest at the base and get narrower toward the top * only 10% of the consumed energy moves up the food chain (from one level to the next) * 90% of energy is used for movement and metabolism by the organism

Answer 114

**predation/herbivory** **competition** * when niches of 2 species are similar, competition results since they're trying to use the same resources (food, water, shelter, territory, etc.) **symbiosis** * relationship between 2 species in which at least 1 organism benefits

Answer 115

**mutualism** * both organisms benefit from the relationship (+,+) * ex. clownfish and anemone **parasitism** * 1 organism benefits while 1's harmed (+,-) * ex. ticks and mammals **commensalism** * 1 organism benefits, 1's unaffected (+,0) * ex. remora and zebra shark | they're all similar in that at least 1 organism benefits

Answer 116

* interspecific: between members of different species * intraspecific: between members of the same species

Answer 117

biodiversity: the variety of life in an area (this can include the variety of species, genes, or ecosystems) * it's important for human purposes (ex. medicine, food, fuel, industrial chemicals) * stabilizes ecosystems by creating more niches (more food, better resistance to disease and climate change) * helps biosphere stay healthy

Answer 118

**habitat fragmentation** * when a habitat’s divided into smaller pieces by human activity * fragments provide less resources than whole intact habitats (less space), increasing extinction probability for many species * decreases opportunities for organisms in 1 area to reproduce with organisms of the same species in another area, which decreases genetic diversity **invasive species** * a species that is from another habitat (may be another continent/country/or region of the same country) * have no natural predators or parasites or regulation or competition to control their population in the new habitat * they may compete with or prey on native species and disrupt the natural food web invasive species, habitat fragmentation, pollution, more predators, disease, competition, etc. can lower the carrying capacity of native species

Answer 119

* carrying capacity: the max population size of a particular species that an environment can support * the carrying capacity of any environment can change over time due to changes in that environment (biotic or abiotic) * invasive species, habitat fragmentation, pollution, more predators, disease, competition, etc. can lower the carrying capacity of native species * if a population exceeds its carrying capacity, resources are DEPLETED

Answer 120

* have a key * have each of the gametes that the parents can give (1 letter) * Punnett square stuff

Answer 121

multiply # of possible alleles from each gene pair | gametes in dihybrid crosses have 2 letters ## Footnote to find specific gametes, do that tree thing

Answer 122

when two pairs of traits are followed in the same crosses, they're found to be inherited independently

Answer 123

* the chance of 2 independent events occurring simultaneously is equal to the product of the separate probabilities

Answer 124

* males and females are usually equally affected * trait can skip generations and reappear later (though it doesn't HAVE to) * if an offspring's affected (has the trait), but neither parent is, both parents must be heterozygous * unaffected heterozygous individuals are called carriers when we're discussing a recessive trait

Answer 125

* males and females are usually equally affected * condition doesn't skip a generation and reappear later * often when a pedigree is

Answer 126

* in a single generation of random mating within a population, the binomial distribution of genes is approximated by the equation p^2+2pq+q^2=1 * p+q=1 * p=dominant allele frequency * q=recessive allele frequency

Answer 127

* term used to describe the interaction of gnes at different loci (positions) on the chromosomes * whenever a gene at one locus influences the expression of a gene at another locus, the first gene is said to be epistatic to the other * first set of genes masks/suppresses the expression of the second set of genes * second gene can be thought of as an on/off switch (in that example of albinism in rats in section iv)

Answer 128

* a species that can regulate the composition of a whole community * without keystone species, ecosystems can collapse * keystone species have trophic cascades ## Footnote trophic cascade is when you have an apex predator controlling the distribution of resources and they lead to these cascades of indirect effects--lots and lots of indirect effects.

finals (I'M BACK ON BRAINSCAPE) Flashcards

for bio 1 final