Fragen zu den Vorlesungen Flashcards
(129 cards)
1
Q
Synapses differ in morphology according to their postsynaptic membrane: Name the three different types depending on the structures from where onto where they’re localized.
(VL Marta; last edit: Inga, 9.3.).
A
- axodendritic synapse: from axon onto dendrite, usually excitatory
- axosomatic synapse: from axon onto soma, usually inhibitory
- axoaxonic synapse: from axon onto axon, usually modulating (can modulate other synapses by inhibition of facilitation)
2
Q
Describe the two different types of synapses depending on their signal transmission.
(VL Marta; last edit: Inga, 9.3.)
A
- chemical synapse: information is transferred through the release of neurotransmitter from one neuron and their detection by an adjacent cell
> AP arrives at axon terminal -> depolarization
> voltage-gated Ca2+ channels open, Ca2+ enters the axon terminal
> Ca2+ causes NT-containing SV to release their contents bei exocytosis
> NT diffuses across synaptic cleft, binds to ligand-gated ion channels on postsynaptic membrane and enters postsynpase -> changes in membrane potential of postsynaptic membrane (EPSPs or IPSPs) - electrical synapse: cytoplasm of adjacent cells is directly connected by clusters of intercellular channels (gap junctions)
> fast (no synaptic delay) and bidirectional
> gap junctions consist of connexon (= half channel) consisting of several connexins
> selective interaction between connexons -> electrical coupling (depends on connexin connection), transmission of metabolic signals (IP3, cAMP)
> GJs are permeable to ions and molecules < 1kDa
> synchronization of large neuronal ensembles
3
Q
Briefly describe the barrel cortex in mice.
VL Marta; last edit: Inga, 9.3.
A
- region of the somatosensory cortex with remarkably high degree of organization
- contains clear pattern of cytoarchitectonic units called ‘barrels’, exclusively found in neocortical layer 4
- barrels are arranged like whiskers on the snout of the mouse: each barrel corresponds to a whisker
- information from whiskers -> cerebellum -> thalamus -> barrel cortex -> motor cortex -> whiskers
4
Q
What is a tripartite synapse?
VL Marta; last edit: Inga, 9.3.
A
- refers to the connection and interaction between pre- and postsynaptic membrane and the surrounding glia cell and their combined contribution to the production of activity at chemical synapses
- can for example be found at several locations in the central nervous system with astrocytes
5
Q
What is Synapto-pHluorin and what is it used for?
VL Marta; last edit: Inga, 9.3.
A
Synapto-pHluorin consists of a pH-sensitive form of GFP and a vesicle-associated membrane protein (VAMP) and is used as an optical indicator of vesicle release and recycling. It is auto-quenched and therefore non-fluorescent inside the SV due to the acidic pH but when released into the more alkaline extracellular environment/synaptic cleft, the presynaptic terminal becomes fluorescent. The SV become re-acidified by endocytosis and the cycle starts again.
6
Q
Describe the difference between excitatory and inhibitory synapses.
(VL Marta; last edit: Inga, 9.3.)
A
- excitatory synapses: ion currents flowing through ion channel cause a DEpolarization of postsynaptic cell which in turn fires an AP
> more than 90% of excitatory glutamatergic synapses in mammalian brain occur on dendritic spines
> asymmetric synapses: pronounced postsynaptic densitiy (PSD)
-> ionotropic glutamate receptors: AMPAR, NMDAR
-> scaffolds: PSD95, Shank, Homer
-> cell adhesion: neuroligins, N-Cadherin - inhibitory synapses: ion currents flowing though ion channels cause a HYPERpolarization of postsynaptic cell which in turn stops firing AP
> inhibitory GABAergic synapses occur primarly on somata, shafts of dendrites and axon initial segments
> symmetric synapses: only slight electron-dense thickening at postsynaptic membrane (less elaborate specialization)
-> GABA(a) receptors, glycine receptors
-> ion: Cl-
-> scaffold: Gephrin (interacts with receptors)
-> cell adhesion: neuroligins
7
Q
Presynaptic proteins at the AZ of vertebrate synapses.
VL Marta; last edit: Inga, 9.3.
A
- Actin
- Abp1
- Piccolo
- Bassoon
- PRA1
- CAST/ERCs (= BRP homologue)
- Liprin-α
- Spectrin
- RIM
- Rab 3
- RIM-BP
> localization of RIM-BP2 at AZ in mouse hippocampal synpases: close to Basson (98nm) and Munc13-1 (115nm), distance between Bsn and Munc13-1 is 116nm - Munc13
- Synaptobrevin
- Syntaxin
- SNAP25
8
Q
What are hippocampal mossy fibres?
VL Marta; last edit: Inga, 9.3.
A
- part of the hippocampal neural network -> hippocampus is crucial for memory and learning
- project from dentate gyrus to CA3 (involved in short-term memory)
- filopodial extensions (‘feet’ of axonal growth cone during exploratory growth) of mossy fibre synapses are specialized to innervate GABAergic cells
9
Q
What are the advantages of a chemical synapse?
VL Niraja; last edit: Inga, 9.3.
A
- signal amplification: signal is not dampened over long distances like in electrical synapses
- inhibitory synapses are only possible through chemical synapses
- high flexibility through differing strengths, transmitter and receptor identities, modulation based on experience, modulation through feedback mechanisms etc.
10
Q
What is quantal release?
VL Niraja; last edit: Inga, 9.3.
A
- each SV contains a ‘quantum’ of NT packed inside of them
- mini excitatory/inhibitory postsynaptic potentials result from spontaneous vesicle fusion in the ABSENCE of presynaptic electrical activity
- in contrast, an AP results in a brief, accelerated, synchronous secretion of quanta to evoke a postsynaptic potential
- the most important thing in release is Ca2+
11
Q
Describe the differences between nano- and microdomain coupling between synaptic vesicles and Ca2+ channels.
(VL Niraja; last edit: Inga, 9.3.)
A
- nanodomain: very small coupling distance (< 50nm) between Ca2+ channel and SV
> high initial SV release probability
> depressing
> less sensitive for Ca2+ buffers - microdomain: larger coupling distance (> 50nm) between Ca2+ channel and SV
> low initial SV release probability
> facilitating
> sensitive for Ca2+ buffers
=> high Ca2+ around the channel means that SV in this area have a high release probability and as the concentration falls further away from the channel, there is a low(er) release probability
12
Q
In regards to SV release, what happens in BRP mutants?
VL Niraja; last edit: Inga, 9.3.
A
- impaired vesicle release: severe deficitis in evokes SV release
- same in RIM-BP mutants
- caused by a mislocalization of presynaptic Ca2+
=> suggests that brp localization is important for the accumulation
13
Q
What do Syd-1, Nrx-1 and Nlg-1 mutants have in common?
VL Niraja; last edit: Inga, 9.3.
A
- larger actives zones which are fewer in number (at the NMJ)
14
Q
What is Syd-1?
VL Niraja; last edit: Inga, 9.3.
A
- presynaptic scaffold protein (DSyd-1 in Drosophila)
- acts together with Nrx-1 and Ngl-1 for normal configuration of AZs
- has PDZ binding domain and binds Nrx-1 through it
- > Syd-1 and Nrx-1 bind each other directly
- is dragged to membrane by Nrx-1 and being localized to AZ
- > Syd-1 influences localization of Nrx-1 at NMJ
- > Nrx-1 is more mobile in Syd-1 mutants
- “early scaffold” together with Liprin-α (and Unc13B)
15
Q
What is spinophilin?
VL Niraja; last edit: Inga, 9.3.
A
- presynaptic protein highly enriched in dendritic spines
- in competition with Syd-1 for binding Nrx-1
- spn mutants have smaller active zones that are higher in number (opposite to Syd-1 mutants)
- forms a less tight complex with Nrx-1 than Syd-1
-> when binding to Nrx-1, Nrx-1 switches from binding Ngl-1 to Ngl-2 - PDZ is imporant because of its binding to Nrx-1 and thereby stopping new AZs from being formed
-> establishing a threshold for AZ assembly as it’s operating as a “sponge” for Nrx-1? - role for AZ structure depends on PDZ domain ligand binding
- controls BRP-complex incorporation during structural plasticity
> binds via CC region the conserved BRP/ELKS-N-terminus
> essential for fast structural plasticity (after 10min)
16
Q
What are the “early scaffold” and the “late scaffold”?
VL Niraja; last edit: Inga, 9.3.
A
- early scaffold: arriving early in formation/configuration of an AZ
> Syd-1, Liprin-α and Unc13B - late scaffold: arriving later in formation/configuration of an AZ
> Brp, RIM-BP and Unc13A
-> Brp and Unc13A predict evoked release at single AZ level
17
Q
What is “loose” and “tight” Ca2+ sensor/channel coupling?
VL Niraja; last edit: Inga, 9.3.
A
- loose Ca2+ sensor/channel coupling: initial Unc13B mediated glutamate release
- > de novo synapse formation
- tight Ca2+ sensor/channel coupling: presynaptic BRP/RBP/Unc13A and postsynaptic GluRIIB incorporation
- > mature synapse
18
Q
What are the hallmarks of a good experimental design?
VL Tina, last edit: Inga, 9.3.
A
- formulate question/goal in advance
> simple, clear, should be possible to answer - comparison/control
> good experiments are comparative: circumstances in different experimental groups (EGs) should be as equal as possible with only ONE thing changig
> EG should rather be compared to concurrent controls than historical ones - replication
> needed to show variation within EG: reduce effect of uncontrolled variation (factors you don’t want to influence your data but they do anyway)
> quantify uncertainty: there are always things you can never influence
> an estimate is of no value without some statement of the uncertainty in the estimate: if you don’t have enough replicates, you can’t say anything about the data - randomization
> experimental subjects (“units/N”) should be assigned to EPs at random
> explicit randomization using a computer/coins/dice/cards..
> to avoid bias (Tendenzen)
> to control the role of chance: randomization allows the later use of probability theory, and so gives a solid foundation for statistical analysis
> the more you randomize, the more it reduces personal bias BUT it’s not perfect for every experiment and might make things more complicated - stratification
> strata = levels, sometimes called “blocking” because you create “blocks” aka groups within the EG
> take account of the difference between periods in your analysis
> example: 20 male/female mice to be tested, half treated and half untreated and only 4 animals can be treated per day -> every day a treated and untreated female and an treated and untreated male BUT order of animals is still random
=> randomization and stratification
> if you can (and want to), FIX a variable
> if you don’t fix a variable, STRATIFY it
> if you can neither fix nor stratify a variable, RANDOMIZE it - factorial experiments
> two or more factors: effect of each factor and their interactions on the response variable
> we can learn more and it’s more efficient than doing all single-factor experiments since we can gain more precise results from a factorial experiment
> additive interactions: the effect of all factors is equal to the sum of the effect of the factors taken separately
> interactive interactions: effect of all factors is NOT simply additive
=> other points
> blinding: measurements made by people can be influenced by unconscious biases
> internal controls: for increased precision it can be useful to use the subjects themselves as their own controls
> representative ability: are the subjects/whatever that you are studying really representative of the population you want to study?
19
Q
Summary of the characteristics of good experiments and how they’re achieved.
(VL Tina; last edit: Inga, 9.3.)
A
- unbiased: > randomization > blinding - high precision: > uniform material > replication > blocking - simple: > protect against mistakes - wide range of applicability: > deliberate variation > factorial designs - able to estimate uncertainty: > replication > randomization > stratification
20
Q
Describe fluorescence microscopy.
VL Marta; last edit: Inga, 9.3.
A
- combines magnifying properties of light microscopy with visualization of fluorescence
- fluorescence is the ability of a fluorophore to emit light after getting excited by light of a certain wavelength; the emitted light has longer wavelength as it loses energy during the state of relaxation after excitation
- > Stokes shift = emission curve (and maximum) is shifted towards far red
- accomplished in conjuction with basic light microscope by addition of a powerful light source, specialized filters and a means of fluorescently labeling a sample
- has a resolution limit
21
Q
What is the resolution of a microscope and how is it calculated?
(VL Marta, last edit: Inga, 9.3.)
A
- resolution = smallest distance between two points that can still be distinguished
- can be calculated with Abbe’s equation: d = λ/2NA
> NA = numerical aperture = n * sinα
-> α = opening angle; n = refractive index (of immersion media)
=> high NA = higher resolution - for emitting object = Rayleigh criterion: a = 0.61 * λ/NA
22
Q
What is the numerical aperture?
VL Marta, last edit: Inga, 9.3.
A
- NA of a microscope objective is the measure of its ability to gather light and to resolve fine specimen detail while working at a fixed object
- NA = n * sinα
> α = opening angle; n = refractive index (of immersion media) - high NA can capture a larger cone of emission light -> higher resolution
23
Q
What is diffraction?
VL Marta, last edit: Inga, 9.3.
A
- diffraction = spreading of light
- in the microscope it can occur at the specimen plane due to interaction of the light with small particles/features and at the margins (Ränder) of the objective front lens or at the edges of a circular aperture within/near the rear (Rückseite) of the objective
- diffraction enables observation of magnified images of specimens in the microscope BUT limits the size of objects than can be resolved
24
Q
What is the Point Spread Function (PSF)?
VL Marta, last edit: Inga, 9.3.
A
- the PSF is the 3D intensity distribution of the image of a point object
-> tiny fluorescent object will look bigger under microscope than it is due to diffraction of light - PSF defines how a point source appears when imaged with the instrument, ideally it would produce a clear one pixel signal but this is impossible due to optical effects
-> instead it appears as complex 3D shape = PSF - depends on light wavenlength, lens NA and optical aberration of the lense
-> PSF defines resolution of instrument
=> two points closer than the width of PSF can’t be distinguished
25
What is deconvolution?
| VL Marta; last edit: Inga, 9.3.
- mathematical transformation of an image that reduces out of focus light
- done by program/software
- knowing the PSF size allows to remove the PSF blurring influence (blurring is a significant source of image degradation in 3D widefield fluorescence microscopy)
26
Describe the principle of STED microscopy.
| VL Marta; last edit: Inga, 9.3.
- STED = Stimulated Emission Depletion -> PSF shrinking
- two laser beams: regularly focused excitation beam is overlaid with a laser beam inducing stimulated emission and featuring at least one zero-intensity point (= STED laser)
-> STED laser has always a longer wavelength than the fluorescence!
- STED laser inhibits fluorescence emission at periphery of excitation: when an excited-state fluorophores encounters a photon that matches the energy difference between the excited and the ground state, it can be brought back to the ground state through stimulated emission before spontaneous fluorescence emission occurs
- STED laser is shaped like a donut via PhaseMod, so emission can only occur at the center of the PSF
- resolutions up to 30-50nm achieved with organic fluorophores
=> increased resolution is obtained by shrinking the PSF via depleting the fluorescence emission in the periphery of the diffraction limited spot using the phenomenon of stimulated emission depletion
- pulsed STED: STED pulse immediately follows excitation pulse, most efficient fluorescence inhibition
- continuous wave (CW) STED: ongoing excitation and STED laser, EGFP and live cell imaging (because fluorophores are optimized for one certain excitation wavelength)
27
What is the "key to achieve super-resolution with STED"?
| VL Marta; last edit: Inga, 10.3.
- non-linear dependence of the depleted fluorophores on the STED laser intensity when the saturated depletion level is approached
- > if it would be linear, it would still be diffraction limited
- > Δx = λ / 2n * sin(α) * √ 1 + I[STED] / I[S]
- if the local intensity of the STED laser is higher than a certain level, essentially all spontaneous fluorescence emission is suppressed; by raising the STED laser power, the saturated depletion region expands without strongly affecting fluorescence emission at the focal point because STED laser intensity is nearly 0 there
28
What is gSTED?
| VL Marta; last edit: Inga, 10.3.
- time gated stimulated emission depletion
- fluorescence is recorded after a time delay T[g] after excitation such that fluorophores have time to see enough STED photons
- reduces blurring
29
What is dual color STED?
| VL Marta; last edit: Inga, 10.3.
- to aquire image in two colours
- dyes should have separated excitation spectra
- overlap of emission spectra for stimulated emission at the depletion wavelength because only one STED laser is used
- combining a classic dye and one with a large Stokes shift works best
30
Apart from STED, what are the other main super-resolution microscopy techniques and how do they work (brief explanation)?
(VL Marta; last edit: Inga, 10.3.)
- patterned illumination: Structured Illumination Microscopy (SIM)
> number of molecules that emit fluorescence are limited in space
> sample plane is excited by patterned wide-field illumination (commonly stripe-shaped pattern); combines with sample structural pattern to form Moiré fringes; Moiré patterns obtained by rotation excitation pattern; algorithm puts all images together and creates super resolution image
> e.g.: reveals localization of newly exocytosed protein in periactive zone
- single molecule imaging: Single Molecule Localization Microscopy (PALM/STORM)
> number of molecules that emit fluorescence are limited in time
> resolution depends on localization precision
> initially samples are inactive/nonfluorescent under illumination bei readout laser; activation laser gets turned on/off; localization of molecules; bleaching of activated structure; localization of next structures
> e.g.: 3D STROM reveals structure of axonal cytoskeleton; dSTORM allows to determine the distance between closest neighbouring clusters
31
What is gene/genome editing?
| VL Janine; last edit: Inga, 10.3.
- targeted modification of genetic information in vivo
- techniques that allow the following modifications:
> insertions
> knock-out
> insertion of mutations
> deletions (e.g. of exons)
> correction of defect genes
32
Which techniques were common before the discovery of CRISPR? What is possible with CRISPR that these techniques lack?
(VL Janine; last edit: Inga, 10.3.)
- 1st generation: Zinc-finger nucleases (ZFN)
> DNA binding = protein based
> relatively short recognition sequence (2x12)
> already in clinical studies
> complex design and production
- 2nd generation: TAL-effector nucleases (TALEN)
> DNA binding = protein based
> few/low off-target (long recognition sequence: 2x20)
> clinical studies started
> design and production relatively easy
- 3rd generation: CRISPR/Cas9
> DNA binding = RNA based
> relatively short recognition sequence (20)
> design and production extremely easy
> initially high off-target-activity-avoidance-strategies in progress
=> CRISPR allows multiplexing (several mutations at the same time in one cell)!
33
Explain the CRISPR technique.
| VL Janine; last edit: Inga, 10.3.
- Clustered Regularly Interspaced Short Palindromic Repeats
- bacterial mechanism to defend against viruses, used for genome editing
- allows deletion, insertion and/or replacement of bases at a specific gene locus (and controls gene expression)
- enables multiplexing: several mutations in the same cell at the same time
- essential components: CRISPR-RNA (crRNA) resp. guideRNA (gRNA), Cas9 enzyme and PAM (Protospacer Adjacent Motif) sequence
- > design of simple chimeric gRNA (chimera of crRNA and tracrRNA) to target any sequence next to a PAM (NGG, NCC) in the genome
- > gRNA forms complex with Cas9 enzyme and this complex binds to homologue target sequence
- > Cas9 cuts DNA by creating a double-strand break (DSB) in the genome, 3bp upstream of PAM
- -> when only deleting a gene: DSB is afterwards repaired by cell by either non-homologous end joining (NHJEC) or homolohy-directed repair (HR)
- -> when inserting new gene: addtionally host RNA that should be put in, complementary strand to host DNA gets synthesized then
- > control via PCR
- > use Cas9 modification Cas9 nickase to minimize off target effects
description of the procedure in Fragenkatalog:
- > search for homologous sequence for designed gRNAs (many Gs and Cs) to bind to
- > gRNAs detect homologues areas via PAM structure
- > homologous arm are designed
- > Cas9 endonuclease cuts genomic target DNA and creates DBS
- > DBS can be repaired by homologous recombination with cassette that is to be inserted or by non-homologous recombination
- > single strand breaks are repaired by homologous recombination with the integrated cassette
- > control via PCR
34
What is the difference between NHEJ and HR in CRISPR?
| VL Janine; last edit: Inga, 10.3.
- are the two major repair pathways of double-strand breaks
- NHEJ = non-homologous end joining
> create knock-outs
> more error-prone
> creates indels (merge of insertion and deletion)
> utilizes no template
> occurs with higher frequency
- HR= homology-directed repair
> create knock-ins, fusions, etc.
> requires a homologous template (donor)
> inefficient but more accurate
35
Briefly describe what was done with CRISPR to the flies we used in the single fly PCR.
(Prakt. Alex; last edit: Inga, 10.3.)
- CRISPR was used to remove the exon that is coding for Unc13B -> K.O. of Unc13B
- dsRed was used to check if the deletion actually worked: foreign DNA and marker; repairing system for deleted exon (via homologous areas at "margins" of deleted exon)
- > Unc13B coding exon was "switched" with dsRed casette
- dsRed is also a promoter that is only expressed in the eyes of the flies -> flies with fluorescing eyes lack Unc13B
36
Name the ingredients of a PCR master mix.
| Prakt. Alex; last edit: Inga, 10.3.
- 10x buffer: stabilizes chemical environment for DNA polymerase
- forward and reverse primer: determine starting point of DNA synthesis and limit it
- dNTPs: for synthesis of complementary strand
- DNA polymerase: replicates DNA
- ddH2O
- template DNA
37
Describe the three major steps of a PCR.
| Prakt. Alex; last edit: Inga, 10.3.
PCR stands for "polymerase chain reaction" and it's a method used for DNA amplification. The procedure consists of three major steps.
1. Denaturation: The DNA that is supposed to be amplified gets denaturated at a high temperature (~95°C), so the primer can later on bind to the single strand). The hydrogen bonds between the complementary bases are broken and the double-stranded DNA template gets split up into two single-stranded DNA molecules.
2. Annealing: The temperature is reduced to so-called "annealing temperature" (usually ~60°C) of the specifically designed forward and reverse primer. The temperature has to be low enough to allow hybridization of the primers to the DNA stand and high enough for the hybridization to be specific.
3. Elongation: Temperature depending on DNA polymerase that is used in the setup. Polymerase synthesizes a new DNA strand complementary to DNA template strand by adding deoxynucleoside triphosphates (dNTPs) from the master mix that are complementary to the DNA template in 5'-to-3' direction.
These three steps are one cycle. For proper amplification, several cycles are necessary.
38
What is important for primer design for a PCR?
| Prakt. Alex; last edit: Inga, 10.3.
- primer should be 18-25bp/MER long
- should end with G or C at the 3' end (stronger binding force)
- they are designed from 5' to 3'
- melting temperature shouldn't be more than 5°C apart between fwd /rev primer
(- 3 to 4 nucleotides are added 5' of the restriction enzyme site in the primer to allow for efficient cutting)
=> example
5' - AATGGAGGTGGTCCTGGAGAAGTGGGATTACGT...- 3'
5' - GTGCAAGTTAGCAAGGTGAAAAAACGAACGCGA...- 3'
FWD: AATGGAGGTGGTCCTGGAGAAGTGG
-> polymerase attaches to 3' end and continues to synthesize in 3' direction; as primers are desgined 5' to 3', here the complementary strand is synthesized, so fwd primer is actually DNA strand
RVS: TCGCGTTCGTTTTTTCACCTTGC
-> see above, rvs primer is complementary strand BUT written the other way round
39
How can you verify by PCR (or phenotypic markers) which fly contains the desired DNA sequence?
Where would you choose specific test primers to bind in order to check if your gene of interest has been integrated into the plasmid?
(Prakt. Alex; last edit: Inga, 10.3.)
- phenotypic markers: e.g. GFP
- PCR: design Primers that are within the desired DNA sequence or flanking it -> PCR won't work if the DNA sequence where the primer binds isn't present
- design primer for homologous areas (present in WT and genomically edited DNA) and another one specifically for the insert/gene of interest -> primer designed for insert can't bind to WT DNA as there's no insert, PCR doesn't work (no amplification) and no band can be seen in the gel after gel electrophoresis whereas the genomically edited DNA gets amplified and shows a band in the gel
40
What is proteomics?
| VL Janine; last edit: Inga, 10.3.
Proteomics is the analysis of the entire protein complement of a cell/tissue/organism. It includes large-scale investigation of proteins, their structure and physiological role or functions. In proteomics we distinguish between functional proteomics, structural proteomics, posttranslational modifications and protein-protein interactions.
41
What is subcellular fractionation?
| VL Janine; last edit: Inga, 10.3.
- cell fractionation = process to separate cellular components while preserving individual functions of each component
- subcellular fractionation is also used to provide an enriched source of a protein for further purification
- e.g. isolation of synaptosomal fraction from fly heads
> fly head homogenate -(centrifugation)-> P1 pellet and S1 supernatant -(centrifugation)-> S2 supernatant and P2 pellet = synaptosome-enriched fraction -> analysis of subfractions taken during the procedure in coomassie-staining (and Western Blot?)
42
What is co-immunoprecipitation?
| VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- lysate + antibody that is coupled to protein A beads
- > binding of antigen
- > pelletizing of antigen
- > washing
- > elution
- > mass-spectrometry analysis
- separating beads from solution: centrifugation at low speed for sepharose beads OR magnet for magnetic beads
43
What is the yeast two-hybrid system (Y2H)?
| VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- works with activation of downstream reporter gene(s) by binding of a transcription factor onto an upstream activation sequence (UAS): TF is split into two separate fragments, the DNA-binding domain (BD, responsible for binding to UAS) and activating domain (AD, responsible for activation of transcription)
- example:
> Gal4 produces two-domain protein (BD and AD) essential for transcription of reporter gene
> 2 fusion proteins are prepared, Gal4BD+Bait and Gal4AD+Prey, and neither of them can initiate transcription alone
> when both fusion proteins are produced AND Bait interacts with Prey, then reporter gene is transcribed
44
What are protein-protein interactomes?
| VL Janine; last edit: Inga, 10.3.
- whole set of molecular and physical interactions among proteins
- Y2H can be used to investigate binary interactions among two proteins at a time
45
What is crosslinking mass spectrometry?
| VL Janine; last edit: Inga, 10.3.
- protein-protein interaction assay
- analyzes interactions that are "locked in place"
- during crosslinking, chemical crosslinkers are used to chemically join components of interacting complexes -> liquid chromatography separation and identification by mass spectrometry analysis
46
What is protein palmitoylation?
| VL Janine; last edit: Inga, 10.3.
- post-translational modification
- covalent attachment of fatty acids (such as palmitic acid) to cysteine residues of proteins
- enhances hydrophobicity of proteins and contributes to their membrane association
- Western blotting to detect palitoylated proteins
- usually reversible
47
Which genotypes and antibodies were used in the experiment for immunofluorescence staining of the Drosophila NMJ?
What was the aim of the experiment?
(Prakt. Tina; last edit: Inga, 10.3.)
```
GROUP A)
- genotypes:
> Ok6-Gal4, UAS:dicer2 x UAS:BRP-RNAi (B3/C8) (III)
-> dicer enables downregulation of BRP
> Ok6-Gal4, UAS:dicer2 x W1118 (PFA fixation) -> control
-> dicer has no effect because there's no RNAi
- primary AB:
> anti-BRP (Nc82) C-term (m), 1:250
> anti-GluRIID (gp), 1:500
- secondary AB:
> Al594 (gp), 1:300
> Al488 (m), 1:500
> HRP-Atto647, 1:250
-> overall staining
- aim:
> localization of BRP and GluIID
> verification of BRP-RNAi
> function of BRP regarding synapse assembly and function?
```
```
GROUP B)
- genotypes:
> Cac::sfGFP/X (methanol fixation)
- primary AB:
> anti-BRP (Nc82) C-term (m)
- secondary AB:
> anti-mouse Al488 (green)
- precoupled primary + secondary AB:
> anti-GFP-Nanobody-Atto647, 1:300
-> use with secondaries only
- aim:
> localization of Ca2+ channel within the synpase
> visualizing resolved architecture of BRP ring around Ca2+ channels
```
We picked male larvae as they can be recognized more easily (testicles). We tried to dissect the same amount of control group animals as experimental group animals for Group A).
48
Briefly describe the technique of live imaging using a desflurane anesthetization chamber.
(VL Tina; last edit: Inga, 10.3.)
- in vivo imaging with intact Drosophila larvae
- specifically adjusted petri dish with hole; larvae is put on "runway" and covered with cover slip; balanced weight on top, so larvae can't move around and stretches are where we want to investigate the synapse; larvae gets anesthetized (NMJs would be jumping around otherwise) with desflurane which reduces heart rate to very low level
- > let normal air in -> let desflurane in, so normal air mixes with desflurane -> normal air has to be kicked out
- investigation under confocal microscope
- at NMJs of muscle 26/27
49
What is axonal transport?
| VL Tina; last edit: Inga, 10.3.
- movement of SV, proteins, lipids and mitochondria through the cytoplasm of the axon between the soma and the synapse
- anterograde axonal transport: from soma to synapse; molecules that are needed in the synpase
- retrograde axonal transport: from synapse to soma; "trash"
- slow axonal transport (0.2-2.5mm/day): carries molecules that are not quickly consumend and utilizes axoplasmic flow -> soluble (cytosolic; e.g. glycolytic enzymes)
- fast axonal transport (up to 400mm/day): utilizes kinesins, dyneins and microtubules; actively walks molecules up/down the axon -> SV precursors, mitochondria, AZ proteins (PTVs?)
> microtubules: providing pathway for intracellular movements
> kinesin: from soma to synapse
> dynein: from synapse to soma
-> under consumption of ATP
-> have two head-domains which are alternatingly attached to the MT and bend before the other head attaches (like foot steps) -> steady movement
-> kinesin tail domain appoints the kind of cargo
-> dynein can not directly bind cargo, need dynactin for mediation
-> may also move microtubules themselves
> myosin: takes intermediately what the others can't take and transports it to synapses; let's status quo at synapses decide what can go in and what can go back
- sushi belt model
50
What is a kymograph?
| VL Tina; last edit: Inga, 10.3.
- axonal transport can be visualized in a kymograph
- x-axis: time
- y-xis: distance
- anterograde transport: from bottom left to top right
- retrograde transport: from top left to bottom right
51
What is FRAP?
| VL Tina; last edit: Inga, 10.3.
FRAP stands for Fluorescence Recovery After Photobleaching and is a technique to measure molecular diffusion and active processes in time. FRAP photobleaching is applied to understand to which extent trafficking vesicles can move between different compartments of cells, the diffusional dynamics and exchange of molecules from one place to another within a cell and to see the speed of response and the amount of cargo carried. Moreover it enables to gain insight into binding and release kinetics of molecules with particular substrates or surfaces to bind.
For FRAP, the region of interest (ROI) is bleached with a laser, removing all fluorescence from this area but not removing the molecules themselves. After time, the fluorescence comes back to the ROI by new molecules diffusing/moving into it. The diffusion coefficient can be determined by measuring the course of fluorescence intensity over time. The later the original fluorescence of the ROI is reached again, the slower is the diffusion of the fluorescing molecule(s).
Molecular kinetics can be fast or slow processes (measured in X = time, Y = distance) and they are visualized in a so-called kymograph.
52
What is an ERG and how do you read it?
| Prakt. Anatoli; last edit: Inga, 10.3.
- electroretinogram (ERG) measures electrical activity generated by neuronal and non-neuronal cells in the retina in response to a light stimulus.
- wild-type flies show stereotypical ERG response:
> light stimulus elicits (hervorrufen) upward voltage spike (= on-transient) from laminar neurons
-> depolarization (curve goes down) of photoneurons elicited from photoreceptor cell (= receptor potential)
-> after end of light stimulus downward spike (= off-transient, repolarization off laminar neurons)
-> voltage rapidly returns to baseline
- in BRP knockdown: BRP is a presynaptic protein that is essential for formation of AZ and therefore signal transmission
> signal from photoneurons won't reach laminar neurons
-> in curve of ERG there won't be an on-transient or off-transient
53
What is spermidine and what can it be used for?
| VL Stephan; last edit: Inga, 10.3.
- spermidine = polyamine, polycation
- influences cellular metabolism
> increased production when metabolism is accelerated
> decreased production when metabolim is slowed down
- endogenous spermidine levels decline with age (in humans as well as in flies)
- oral uptake of spermidine can kind of "re-juvenate" flies
> protects age-sensitive (= anesthesia sensitive memory ASM) memory component
- spermidine supplementation shown to boost autophagy and lifespan in aging yeast and mice
> aging is associated with autophagic decline
> autophagy is thought to be neuroprotective
54
Explain the connection between age-induced changes of the presynaptic structure/function and memory impairment in Drosophila.
(VL Stephan; last edit: Inga, 10.3.)
- BRP/RBP/Unc13 scaffold (T-bar) size controls structural and functional plasticity of individual AZs
- > age-induced changes of presynaptic structure and function involved in memory impairment?
- increased T-bar SIZE and BRP/AZ
- > age-induced brain-wide increase of BRP can be suppressed by spermidine
- release of SV increases at aging projection neuron synapses
- dietary spermidine increases mitochondrial mass and respiratory capacity
55
What effect has spermidine feeding in the mouse memory center?
(VL Stephan; last edit: Inga, 10.3.)
- increases long-term plasticity at aged MF-Ca3 synapses
- increases mitochondria density at mouse MF bouton
- > efficacy of the respiratory chain tends to diminish as cells and organisms age
56
What is hypusination?
| VL Stephan; last edit: Inga, 10.3.
- unique post-translational modification modifies single lysine of translation initiation factor elF5A
- 4 Cs transferred to lysine
- eIF5A is required for autophagy by mediating ATG3 translation
57
Which factors influence the observed fluorescence intensity in fluorescence microscopy?
(VL Marta; last edit: Inga, 10.3.)
- extinction coefficient of fluorophore: how likely a photon of the appropriate wavelength will be absorbed (sometimes called "cross-section") -> bigger is better
- quantum yield of fluorophore: percent of absorbed photons that generate emitted photons
- concentration of fluorophore (e.g., acces of fluorophore to deep structures)
- wavelength of exciting light
- emission filters (broad vs narrow band)
- numerical aperture (NA) og objective
- magnification intensity α 1/(mag)^2 (not an issue with laser scanning "zoom")
- ionic milieu (quenching)
- bleaching
- SNR (background)
- transmission of objectives and filters (UV and IR often absorbed)
- degradation of fluorophore
- path length due to scattered light from samples
58
What is confocal microscopy and its advantages?
| VL Marta; last edit: Inga, 10.3.
- big advantage: possibility to collect light exclusively from a single plane
- allows higher in-depth resolution with less background
- a pinhole sitting conjugated to the confocal plane keeps light from detector that is reflected/emitted from others than the focal plane -> key feature, essential for 3D
- samples are scanned sequentially point by point and line by line and pixel information is assembled to one image -> optical slices are imaged with high contrast and resolution in x, y and z
- by moving the focal plane, single images (optical slices) can be put together to build up a 3D stack that can be digitally processed afterwards
- thickness of an optical section is directly controlled by: objective, wavelength and pinhole diameter
59
What is the detector in confocal microscopy?
| VL Marta; last edit: Inga, 10.3.
- detector = photomultiplier tube (PMT)
> photon enters PMT, strikes photocathode
-> production of electrons as a result of photoelectric effect
-> electrons are directed towards electron multiplier (dynode)
-> electrons get multiplied, signal is detected by anodes
- confocal "standard" PMT detectors are based on photocathode material with a wide spectral response from UV to near-IR
> multi-alkali PMT: quantum efficiency decreases with increasing wavelength
> GaAsP (Gallium Arsenide Phosphode) is a semiconductor material with ideal characteristics for converting photons into electric signals: quantum effiency increases up to peak at ~550nm and then decreases
-> higher sensitivity, better image quality, higher acquisition speed
60
Describe the phenomenon of fluorophore emission cross-talk and explain how it can be avoided in confocal microscopy.
(VL Marta; last edit: Inga, 10.3.)
- colocalization in the context of digital imaging: colors emitted by fluorescent molecules sharing the same pixel in the image
- different emitted signals can't be distinguished as they're detected in the same channel
- > e.g.: simultaneuos detection of Alexa488 and Alexa555 will lead to cross-talk as both signal are detected in the red channel
- cross-talk can be avoided by sequential detection
- > e.g.: take first image of Alexa488 (Cy3 not excited) and second image of Alexa555/Cy3 (Alexa488 not excited)
- cross-talk can be avoided by using dyes without overlapping emission spectra
- > e.g.: Alexa488 and Cy5
61
Which parameters influence the image quality in confocal microscopy?
(VL Marta; last edit: Inga, 10.3.)
SAMPLE
- sample thickness
- dyes fit to available lasers
- dye emission overlap
- dye brightness
- antifading media
- embedding media
- no background
CONFOCAL
- objective
- speed
- laser power
- gain
- pinhole
- detectors
- image resolution/scan zoom
- simultaneous/sequential acquisition
62
What is the resolution limit of a microscope?
| VL Marta; last edit: Inga, 10.3.
- when two points closer than the width of the PSF can't be distinguished anymore
- > two points will appear as a single object and are unresolvable from each other
63
What is the difference in the olfactory system between adult Drosophila and their larvae?
(VL Atefeh; last edit: Inga, 10.3.)
- larval olfactory system is much simpler
> 21 ORNs (vs. 1.300 ORNs)
> 21 LAL glomeruli (vs. 43 AL glomeruli)
> ~21 PNs (vs. 150 PNs)
> ~28 calycal glomeruli (vs. hundreds of calycal glomeruli)
> ~600 MB γ neurons (vs. 2.500 MB neurons)
64
Describe the olfactory system in adult flies.
| VL Atefeh; last edit: Inga, 10.3.
- odor binds to olfactory receptors (OR) in dendrites of olfactory receptor neurons (ORN) in antennae and maxillary palps
- > transported as AP via axons of ORN to antennal lobes where there are ~50 glomeruli with synapses
- > antennal lobes are surrounded by soma of the olfactory projections neurons ([O]PNs), dendrites of the PNs are in the glomeruli
- > each PN generally receives information from a single glomerulus
- > axons of PNs send information to higher brain centers, the mushroom body (MB, center of learning and memory) and the lateral horn (responsible for innate responses)
- > in the MB: Calyx (= dendrites of the Kenyon cells that are the soma of the MB neurons) receives information from PNs (+ MB lobes are axons of Kenyon cells, there are α/β, α'/β' and γ -> α and β are originated from the same cell; α and α' are vertical; β, β' and γ are horizontal; γ do not branch!
- > processing of information and behavioural output (e.g. approach or avoidance) OR innate response (lateral horn)
65
Describe appetitive and aversive learning/conditioning. Which one was used in the experiment where we tested larval learning? Which genotypes were used in that experiment?
(VL Stephan/Atefeh, Prakt. Christiane; last edit: Inga, 10.3.)
- appetitive learning: positive unconditioned stimulus (US) paired with conditioned stimulus (CS+) vs. unpaired conditioned stimulus (CS-)
- > e.g.: US = food/sugar, CS+ = odor A, CS- = odor B; training; test = choice between A and B; A should be chosen
- aversive learning: negative unconditioned stimulus (US) paired with conditioned stimulus (CS+) vs. unpaired conditioned stimulus (CS-)
- > e.g.: US = salt/bitter taste/electric shock, CS+ = odor A, CS- = odor B; training; test = choice between A and B; B should be chosen
- we tested appetitive associated learning in Drosophila larvae
- genotypes: W1118 and Or83b knock-out (needed to smell)
- US = sugar, CS+ = n-amyl acetate (AM) with fructose, CS- = 1-octanol (OCT) pure
- reciprocal setup (to avoid that prior existing odor preferences influence results): US = sugar, CS+ = OCT with fructose, CS- = AM pure
66
How did we calculate the preference indexes and the learning index in appetitive associated learning in Drosophila larvae?
(Prakt. Christiane; last edit: Inga, 10.3.)
Preference Index A (PI-A)
PI-A = (# larvae [AM] - # larvae [OCT]) / (# total larvae)
Preference Index B (PI-B)
PI-B = (# larvae [OCT] - # larvae [AM]) / (# total larvae)
```
Learning Index (LI)
LI = (PI-A + PI-B) / 2
> LI = -1 = aversive learning (larvae didn't go to odor that was presented with fructose)
> LI = 0 = no learning
> LI = 1 = appetitive learning (larvae went to odor presented with fructose)
```
67
What is the mushroom body? Describe its structure.
| VL Stephan/Atefeh; last edit: Inga, 10.3.
- center of learning an memory in Drosophila (and other insects)
- is a neuropil (region of high synaptic density with relatively low amount of somata)
- MB neurons consist of:
> Kenyon cells: clustered, ~2.500 in each hemisphere, are the soma of the MB neurons
> Calyx: claw-like structure, are the dendrites of the Kenyon cells and receive information from the axons of the projection neurons
> mushroom body lobes: are the axons of the Kenyon cells; there are different types = α/β, α'/β' and γ -> α and β are originated from the same cell, α and α' are vertical; β, β' and γ are horizontal; γ do not branch!
- in MB punishment (PPL1) or reward (PAM) signaling through dopamine that result in approach or avoidance in behavioral output
68
Name and explain the different memory phases that exist in Drosophila!
(VL Stephan, Prakt. Christiane/Oriane; last edit: Inga, 10.3.)
- short-term memory: for a few minutes, does not require repetitive training, in experiment flies are tested 5 min after exposure to stimuli
- mid-term memory: for up to few hours; in experiment flies are tested 1h after exposure to stimuli or 3h if interested in ARM & ASM
- anesthesia resistent/sensitive memory: 2,5h after exposure to stimuli, flies receive a 90s cold shock followed by 30 min recovery time
- > ARM: ability to keep memory after shock
- > ASM= MTM – ARM
- long-term memory: for 24h up to a few days, requires repetitive training (e.g. 10 times training session); in experiments flies are tested 24h after training
69
How does excitation-secretion coupling work?
| VL Stephan; last edit: Inga, 10.3.
- docked to presynaptic membrane and primed SV form readily releasable pool (SV are primed to they can fuse rapidly; involves partially assembled SNARE complexes; (M)un13, RIM-BP and RIM participate)
- > AP arrives and depolarizes presynaptic membrane
- > voltage-gated Ca2+ channels open, Ca2+ influx
- > Ca2+ triggers exocytosis of SV by binding to synaptotagmin in membranes of SV
- > primed SV fuse quickly in response to Ca2+ elevations
- > NTs inside the SVs are released into the synaptic cleft by exocytosis and bind to ligand-gated ion channels on postsynaptic membrane and enters postsynapse
- > exocytosis occurs at release sites within specialized areas at the presynaptic membrane (active zones) that are defined by their spatial proximity to voltage-gated Ca2+ channels and the presence of cytoplasmic matrix of the active zone (CAZ) scaffold proteins
- > endocytosis of SV membranes including transmembrane SV cargo proteins occurs at the periactive zone that surrounds the AZ
- > predominantly mediated by clathrin- and dynamin-dependent pathway involving endocytic scaffolds
- > uncoating of SV and NT uptake
- > return to recycling pool, clustering
70
Important proteins in the SV release machinery?
| VL Stephan; last edit: Inga, 10.3.
- Unc13(A/B): release factors, essential to dock SV to AZ
| - synaptotagmins: act as Ca2+ sensors for SNARE-mediated SV fusion
71
What is short-term plasticity?
- ability of synapses to adjust in response to their activity for a short time (tens of ms to a few minutes)
- can strengthen or weaken synapse
- controls capacity and content of information transmitted
72
What is an NMJ?
| VL Stephan; last edit: Inga, 10.3.
- neuromuscular junction
- chemical synapse between motor neuron and muscle fiber
- transmission of an electrical signal to muscle fiber and transform it into muscle reaction (contraction) -> innervates muscle and allows muscle contraction
73
What is the T-Bar?
| VL Stephan; last edit: Inga, 10.3.
- structure formed by two core components RIM-BP and BRP (ELKS family)
- characteristic for Drosophila AZs
74
What is an active zone (AZ)? What is the AZ scaffold (of a mature synapse) and what is its function? Name three major components.
(VL Stephan; last edit: Inga, 10.3.)
- region of the presynapse where SV fuse with presynaptic membrane and NT release is initiated
- AZ scaffold describes several proteins that stabilize, support and ease SV fusion and their exocytosis, clustering of Ca2+ channels
- BRP, RIM-BP, Unc13A, Cacophony...
75
Name three proteins implied in building a synapse. What are their functions?
(VL Stephan, Quicktest; last edit: Inga, 10.3.)
- BRP: cytoskeletal protein, e.g. important for integrity of T-bars at pre-active zones, contributes to Ca2+ channel clustering
- Unc13 (release factors Unc13 A/B): essential for synaptic transmission, different isoforms can be found in different concentrations in different synapses
- RIM-BP: regulation of Ca2+ channel accumulation ("fine tuning")
- SNAP-25: component of trans-SNARE complex -> important for specificity of membrane fusion, executes fusion by bring SV and plasma membrane together
- SNARE proteins: mediate vesicle fusion
- Neurexin-1 (NRX-1): required for synpase formation
- Synapse defective-1 (Syd-1): together with Liprin-α "master organizer" of synaptic differentiation
76
What are the two isoforms of Unc13 at Drosophila AZs and how do they differ from each other?
(VL Stephan; last edit: Inga, 10.3.)
- Unc13A and Unc13B: different N-termini from one locus
- loss of Unc13B: MODERATE reduction of SV release
- > spares fast ORN-PN transmission, imprtant for tonic response
- loss of Unc13A: DRASTIC reduction of SV release and imprecise timing
- > interferes with fast phasic, quickly depressing release component
- co-existence of two independent release pathways with few tens of nanometers at individual AZ
- Unc13 clusters define SV release sites
- differentiate molecular spacing: SV - Ca2+ channel distance tunes short-term plasticity
77
What are foward and reverse genetics?
| VL Atefeh; last edit: Inga, 10.3.
- forward genetics: from phenotype to gene
| - reverse genetics: from gene to phenotype
78
Name different types of mutagenesis and explain how they work (forward genetics).
(VL Atefeh; last edit: Inga, 10.3.)
1. physical mutagenesis using ionizing radiation X-ray or UV
- cause breaks in DNA -> deletions or chromosomal rearrangements
- easy to map, but often not limited to single genes -> not good for fine-scale mutagenesis
2. chemical mutagenesis using ethyl methanesulfonate (EMS) or ethidium bromide
- causes point mutations
- allows for many different mutations with gene regions, but very difficult to map
3. insertional (transposon) mutagenesis: transposable elements containing marker gene(s) are mobilized in genome
- transposon can insert within coding region and disrupt amino acid sequence or may insert into neighbouring non-coding DNA affecting intron splicing or gene expression
- can be easily mapped and region of genome cloned
79
What are techniques used in reverse genetics?
| VL Atefeh; last edit: Inga, 10.3.
1. large-scale random mutagenesis and screening
- screen gene of interest for nucleotide changes
- requires screen of 1000s to 10000s of individuals
- done by performing PCR on GOI
2. transposable element excision (especially useful in Drosophila)
- marked transposons at unique chromosomal location
- introduction of source of transposase -> transposons will excite with some frequency -> loss of marker gene
- transposon excision can also result in deletion of flanking DNA
- precise and imprecise excision
3. RNA interference (RNAi)
- double-stranded RNA (dsRNA) can lead to specific posttranscriptional gene silencing (PTGS)
- mechanism is part of a natural response of the host
80
Explain the mechanism of RNAi.
| VL Atefeh; last edit: Inga, 10.3.
- RNAi = RNA interference
- used for posttranscriptional gene silencing
- process:
1. doubled-stranded RNA (dsRNA) is processed into 21-23nt fragments, the short-interfering RNA (siRNA), by the enzyme dicer
- > ribonuclease composed of three structurally rigid regions connected by flexible hinges and propose that conformational flexibility facilitates dsRNA binding and processing
- > ATP-dependent RNA helicase domain, RNAse III motifs and dsRNA binding domain
- > siRNAs have a defined structure: 19nt duplex and 2nt 3' overhangs
2. antisense strand of siRNA guides cleavage
- > one strand incorporated into multi-subunit ribonucleoprotein complex and directs RISC to target mRNA by complementary base-pairing
- > RISC = RNA-induced silencing complex; active part = argonaute proteins -> cleave target mRNA strand complementary to their bound siRNA
3. mRNA gets degrated
81
What are microRNAs (miRNAs)?
| VL Atefeh; last edit: Inga, 10.3.
- RNAi = interference RNA, is used for gene silencing
- RNAi either blocks/inhibits translation or destroys mRNA
- > this mechanism is part of a natural response of the host that most likely evolved to control viruses or transposon replication
- miRNAi/microRNA are single-stranded, genomically encoded non-coding RNAs
- processed by enzyme Dicer, interact with RISC-complex
- mature miRNAs are similar to short interfering RNAs (siRNAs) produced from exogenous double-stranded RNA (dsRNA)
82
Which four different types of RNAi reagents are used for in vivo studies?
(VL Atefeh; last edit: Inga, 10.3.)
1. synthetic siRNAs
- small RNA duplexes of 19 complementary bps and 2nt 3' overhangs
- transfected into cells or injected into animals
- effects are transient
2. small hairpin RNAs (shRNAs) and
3. small hairpin microRNAs (shmiRNAs)
- synthesizing vectors allow for controlled or continuous expression of small transcripts in cell that contain both sense and antisense strand complementary to selected mRNA target
- either transfected as plasmid DNAs or delivered using viral particles and maintained as extra-chromosomal copies or stably integrated in genome as transgenes
- shRNAs are processed in cytoplasm by Dicer to generate siRNAs
- shmiRNAs: sequences for silencing trigger are embedded in endogenous miRNA expression cassette -> therefore exploit endogenous miRNA pathway for biogenesis and subsequent loading of siRNAs onto RISC -> usually more effective in knocking down target mRNAs
4. long dsRNAs
- 200-500nts in length
- can be injected into animals, delivered via bacteria, expressed as transgenes or delivered into cultured cells by transfection or bathing
83
What is the normal resting membrane potential in mV of muscle 6 at the Drosophila NMJ during electrophysiological recordings?
(Prakt. Torsten; last edit: Inga, 10.3.)
> -60 to -70mV
84
What is an mEJC or miniature excitatory junctional current?
| Prakt. Torsten; last edit: Inga, 10.3.
An mEJC is the postsynaptic response to the spontaneous (= no stimulus!) presynaptic release of a single SV.
85
When we do a paired pulse experiment, what are we referring to and what can we determine from this type of experiment?
(Prakt. Torsten; last edit: Inga, 10.3.)
In a paired pulse experiment there are given two consecutive stimulations with a short interstimulus interval (ISI, in our case 10 or 30ms). With this type of experiment we can gain insight into short-term synaptic plasticity and vesicular release probability.
86
Briefly describe the function of the three electrodes that are used in Two Electrode Voltage Clamp (TEVC) electrophysiological recordings.
We use two sharp microelectrodes during normal recordings: one sharp microelectrode is used to constantly record the membrane potential of the cell and the other one is used to pass current into the cell to "clamp" the membrane potential at the predetermined command potential. The third electrode is the fire-polished suction electrode that is used to stimulate the motor axon innervating the muscle being recorded.
87
What is the most important cation for proper synaptic transmission at the Drosophila NMJ?
This cation is also added to the bath solution to mediate transmission. What is the approximate physiological extracellular concentration of this cation?
(Prakt. Torsten; last edit: Inga, 10.3.)
The most important cation for synaptic transmission at the Drosophila NMJ is Ca2+. CaCl2 is added to the bath solution during TEVC recordings with an approximate physiological extracellular concentration of 1 - 1.5mM.
88
What is the neurotransmitter at the Drosophila NMJ?
| Prakt. Torsten; last edit: Inga, 10.3.
- glutamate
89
How would you determine the approximate number of SV released following a single action potential?
(Prakt. Torsten; last edit: Inga, 10.3.)
First, we would have to determine the amplitude of the postsynaptic response to the release of a single SV. This can be accomplished via recordings of mEJC. Once this amplitude is determined, we then can use a stimulation protocol ti determine the evoked excitatory junctional current (eEJC) amplitude that is the postsynaptic response to the presynaptic release of MANY SV following initiation of an AP. The eEJC amplitude can then be divided by the average mEJC amplitude to determine the approximate number of SV that were released following a single AP.
90
Describe antibody staining. Why do we use two antibodies? What is triple staining (we did for the fly brains)?
(Prakt. Atefeh; last edit: Inga, 10.3.)
- primary antibody specifically binds to protein/structure to be labeled
- secondary antibody specifically binds to the first antibody and is conjugated with a fluorophore
- triple staining: 3 different primary antibodies from 3 different animals and therefore 3 different secondary antibodies
- for frequently used structures there are already marker-causing first antibodies:
> Nc82, N488: BRP
> GluRII D, Cy3: glutamate receptor
> Cy5: HRP (all neuronal membranes)
91
Where did the different driver lines express in the olfactory system in our brain staining experiments?
(Prakt. Atefeh; last edit: Inga, 10.3.)
- Orco-Gal4 (III) x UAS: mcD8-GFP (III)
- > Orco>GFP
- > olfactory receptor neurons
- GH146-Gal4 (III) x UAS: mcD8-GFP (III)
- > GH146>GFP
- > olfactory projection neurons
- MB247-Gal4 (III) x UAS: mcD8-GFP (III)
- > MB247>GFP
- > mushroom body neurons
92
Explain the process of immunofluorescence staining.
| Prakt. Atefeh; last edit: Inga, 10.3.
- > DISSECTION (of brain) in cold Ringer solution (keeps brain intact)
- > FIXATION in 4% PFA (crosslinking with proteins)
- > WASHING in 0,7% PBT (removes PFA -> PBS + Triton = PBT, makes membrane permeable)
- > BLOCKING in 0,7% PBT and 10% NGS (to avoid unspecific bindings of secondary AB)
- > INCUBATION with primary AB (binds specifically to protein/structure of interest)
- > WASHING in 0,7% PBT (to remove unbound primary ABs)
- > INCUBATION with secondary AB (binds specifically to primary AB and is conjugated with fluorophore)
- > WASHING
- > MOUNTING (with Vectashield to adjust diffraction index and prevent sample from dehydration or bleaching)
- > ANALYSIS
93
Why use Triton in IF staining?
| Prakt. Atefeh; last edit: Inga, 10.3.
- enables membrane permeability, so antibodies can enter the cell
94
Why use paraformaldehyde (PFA) in IF staining?
| Prakt. Atefeh; last edit: Inga, 10.3.
- fixation of proteins, carbons and lipids in the cell
- cells survive further treatments
- stops all degradation processes
95
Why use PBS / PBT in IF staining?
| Prakt. Atefeh; last edit: Inga, 10.3.
- used for washing the cells to remove fixation solution and unbound antibodies.
- PBT is PBS with Triton, for simultaneous creation of permeability during washing
96
Why use normal goat serum (NGS) in IF staining?
| Prakt. Atefeh; last edit: Inga, 10.3.
- used for blocking to prevent non-specific binding of antibodies
- non-specific epitopes are blocked to minimize that the second antibody binds them
97
What is a P-element?
| VL Atefeh; last edit: Inga, 10.3.
= transposable P-element
- transposable elements are so-called „jumping genes“ that can move from one position in the genome to another
- transposable P-element is one of the best studied mobile DNA elements in eukaryots (eukaryotic cut-and-paste-transmission)
- needs enzyme Transposase
- length of 2907 bp with four exons and three introns
- 31bp terminal inverted repeats (TIR)
- 11bp internal inverted repeats (IIR) located ~ 100bp from the ends
- tranposase enzyme recognizes 31bp TIR and catalyzes P-element excision and re-insertion -> only produced in germ line (because splicing event needed to make transposase mRNA does not occur in somatic cells)
- regulated by piRNA (PIWI-interacting RNA)
> small non-coding RNAs that are generally 24-35nts
> act to suppress TE expression in animal gonas
- suppress TE activity in germ line
> maternal transmission of piRNA
- regulated by KP element
> inhibits P-element transposition
98
What is hybrid dysgenesis?
| VL Atefeh; last edit: Inga, 10.3.
- describes collection of symptoms including high rates of sterility, mutation induction, male recombination (doesn't normally occur in Drosophila), chromosomal abnormalities and rearrangements
- P-M hybrid dysgenesis: two strains of Drosophila; P strain WITH P elements and M strain WITHOUT
> manifest when crossing P strain males with M strain females
> eggs of P strain females contain high amounts of repressor protein that prevents transcription of transposase gene
> piRNA: supresses TE activity in germ line, maternal transmission of piRNA
99
What is transformation?
| VL Atefeh; last edit: Inga, 10.3.
Technique using one helper protein coding for transposase without a recognition sequence (to prevent insertion) and a P-plasmid containing transposase recognition sequences. A marker gene, the gene of interest and an E. coli selectable marker gene are injected into an early stage embryo resulting in random transposition. This transposition needs to be in the germ line to be passed on to the offspring -> marker gene in next generation gives evidence.
100
Insertional mutagenesis?
| VL Atefeh; last edit: Inga, 10.3.
- technique used in forward genetics
- random transposition can lead to a loss of a gene at the insertion site
- insertion tends to occur near actively transcribed genes as the chromatin structure is loosest here, so the DNA is most accessible
101
What is an enhancer trap?
| VL Atefeh; last edit: Inga, 10.3.
Transcriptional enhancers are DNA sequences that control expression of nearby genes and direct tissue-specific, positive regulation of these genes (Karo, 2002; Griffiths et al., 2002). Enhancers are often located 1kb or more from the target promoter and they might be upstream, downstream or even within the transcription unit they control.
An enhancer trap utilizes a recombinant transposon construct that is inserted into the genome and will express a reporter gene product only in certain cells when its inserted near an enhancer that is specific for these cells (e.g., LacZ).
102
Explain the Gal4/UAS system.
| VL Atefeh, Prakt. Christiane/Oriane; last edit: Inga, 10.3.
- system commonly used in Drosophila to drive expression of a gene of interest
- GAL4 protein (derived from yeast) is expressed in a cell- or tissue-specific pattern and is kept with an endogenous promoter/enhancer in one fly line, the so-called driver (GAL4 expressing) line
- Upstream Activation Sequence (UAS) is an enhancer that is specific to GAL4 and is kept together with a specific gene of interest in another fly line, the responder (UAS-target gene) line -> gene of interest is silent in the absence of GAL4!
- when these lines are crossed, in the progeny of this cross GAL4 protein will bind to UAS and drive the expression of the target gene in a cell- or tissue-specific pattern
- other GAL4 systems:
> TARGET system: uses GAL80 for temporal control of GAL4-UAS-based
> inducible GAL4 system: GAL4 is coupled with a hormone receptor -> transcriptionally active in the presence of the hormone, transcriptionally inactive in the absence of the hormone
> split-GAL4 system: GAL4 is split up -> transcriptionally active when expressed in the same cell, otherwise silent
103
```
What are (adult) markers in Drosophila? Name and explain.
(Prakt. Christiane/Oriane; last edit: Inga, 10.3.)
```
Markers are alleles of genes coding for easy to see features (eye, wing, bristles).
- > colour: wildtype, ebony -/- (e), yellow -/- (y)
- > eyes: white -/- (w), mini white (w+), Bar +/- (B), Drop +/- (dr), Irregular Facets +/- (If)
- > wings: Curly +/- (Cy), Serrate +/- (Ser), vestigial -/- (vg)
- > bristles: Humeral +/- (Hu), Pin+/- (Pin), Stubble +/- (sb), singed -/- (sn)
104
What are balancers?
| Prakt. Christiane/Oriane; last edit: Inga, 10.3.
= balancer chromosome
- chromosomal rearrangements that allow lethal mutations to stably maintain in heterozygotes
- > if an allele is lethal as homozygotes, balancers are used to keep the stock viable
- > balancers are lethal as homozygotes and in recombination
- inhibits crossing-over
- for tracking: marker on balancer chromosome (can be identified phenotypically or are lethal as homozygotes)
- different balancers exist for 1st, 2nd and 3rd chromosome, each with a phenotypic marker
105
Name advantages and disadvantages of Drosophila as a model system.
(VL Stephan; last edit: Inga, 10.3.)
ADVANTAGES:
- small genome
- known genome
- low maintenance costs
- saves space
- relatively easy to manipulate
- short life cycle
DISADVANTAGES:
- research results not (100%) transferable to humans because its not a mammalian system
- high risk of contamination through other genotypes
- material can't be easily frozen like bacteria
- handling requires more training due to small size
106
Briefly describe the life cycle of Drosophila melanogaster.
| VL Stephan; last edit: Inga, 10.3.
adult -> fertilized egg -(cleavage)-> syncytial blastoderm -(gastrulation)-> embryo ->(hatching)-> 1st instar larva (ca. 1 day after fertilization) -> 2nd instar larva (ca. 2 days af) -> 3rd instar larva (ca. 6 days af) -> pre-pupa (for ~2 days) -> pupa (for ~ 3 days) -(metamorphosis)-> adult
- at 25°: 10-12days; slower at <25°; faster at >25°
107
Why is research in Drosophila relevant for humans?
| VL Stephan; last edit: Inga, 10.3.
- 70% of all genes and 80% of human "disease genes" conserved in Drosophila
- > mis-epxression of a HUMAN eye development gene (Pax6) triggers ectopic eyes in Drosophila
108
In short-term Memory test, why do we need to train two separate groups of flies reciprocally, that is, one group received OCT (with shock) and MCH (without shock), and the other group received MCH (with shock) and OCT without shock?
(Prakt. Christiane/Oriane, Quicktest; last edit: Inga, 10.3.)
- to compensate for preference / repulsion
- > results must be averaged to rule out that the flies from the outset prefer a particular fragrance -> normalization to fragrance preference
- > odor preference is always there, stronger in one direction as shock and odor preference come together -> data fusion balances preference
- flies are usually distributed equally on OCT / MCH, so only the compensation is checked
- eliminate errors in fragrance dosing
109
What is a bouton?
| Quicktest; last edit: Inga, 10.3.
A (small) swelling at the terminal ends of axons containing an AZ with synaptic vesicles and neurotransmitters.
110
What is the difference between confocal and wide-field microscopy?
(Quicktest; last edit: Inga, 10.3.)
- confocal microscopy:
> higher in-depth resolution with less background and better contrast
> several sample z planes are scanned (point to point -> image), images can be stacked to high resolution 3D image that can be digitally processed
> confocal microscope has pinhole: essential for 3D
- widefield microscopy
> entire sample is illuminated (no z planes) -> more noise because background is illuminated, too
> only 2D image
111
Is it possible to simultaneously image two proteins in vivo? How would you label them? Explain in this context the principle of fluorescence.
(Quicktest; last edit: Inga, 6.3.)
Yes, the proteins can be labeled with different fluorophores that have different emission (and excitation) spectra (e.g. GFP and RFP).
Flurorescence is the ability of a fluorophore to emit light after getting excited by light of a certain wavelength - hereby the emitted light always has a longer wavelength as it loses vibrational energy during the state of relaxation after the excitation.
112
How do you determine experimentally the differences in spatial coupling of synaptic vesicles to voltage gated calcium channels? (Mouse)
(Quicktest; last edit: Inga, 10.3.)
By the use of the (slow) Ca2+ chelator EGTA (and BABDA). When an AP reaches the presynapse and opens the voltage-gated Ca2+ channels, EGTA binds the inflowing Ca2+. Ca2+ will not reach the SV in the periphery and therefore, these vesicle will not fuse with the presynaptic membrane and the enclosed NTs can't be released into the synaptic cleft.
Rebecca: This leads to a decreased amplitude of the eEJC.
-> IF staining for Ca2+ channel + release factor -> STED (Kommentar von Thorsten auf meinem Test...)
113
What are the differences/similarities between the AZ of Drosophila and mice?
(VL Marta; last edit: Inga, 10.3.)
DIFFERENCES:
- level(s) of genetic redundancy -> knockout of one component has much worse effect in Drosophila
- AZ of mice is more complex
SIMILARITIES:
- similar components -> either the same (e.g. RIM-BP) or homologues (BRP in flies, CAST/ERCs in mice)
114
Which fly lines where used for our experiments and what were the aims of each?
(last edit: Inga, 10.3.)
For immunofluorescence staining:
- brain:
> Orco-Gal4 (III) x UAS: mcD8-GFP (III)
> GH146-Gal4 (III) x UAS: mcD8-GFP (III)
> MB247-Gal4 (III) x UAS: mcD8-GFP (III)
-> aim of experiment: localization of Drep2 & BRP at the olfactory pathway synapses; visualization of Orco-Gal4, GH146-Gal4 & MB247-Gal4 expression patterns (olfactory pathway)
- NMJ:
> Ok6-Gal4, UAS:dicer2 x UAS:BRP-RNAi (B3/C8) (III)
> Ok6-Gal4, UAS:dicer2 x W1118 (PFA fixation)
> Cac::sfGFP/X
-> aim of experiment (Ok6-Gal4 lines): localization of BRP & GluIID, verification of BRP-RNAi and function of BRP regarding synapse assembly & function
-> aim of experiment (Cac): localization of Ca2+ channels within synapse & visualizing the resolved architecture of BRP ring around Ca2+ channel
- ERG:
> GMR-Gal4(X) x UAS-BRP-RNAi (B3/C8) (III)
> GMR-Gal4(X) x W1118
> could NOT be used: GMR-Gal4(X) x UAS:ButaliniumToxin (III) because effects of toxine are lethal
-> aim of experiment: determination of BRP downregulation phenotype regarding synapse function of eye synapses (+ effect of blocking NT release using Butalinium toxine in eye synapse)
115
What is a synapse and which components (functions) can be found there?
(last edit: Inga, 10.3.)
Is a transmission relay (chemical synapse (NMJ), electrical synapse with gap junctions and connexones).
Chemical synapse:
- presynapse: with AZ, vesicles are collected on scaffold structure (BRP RIM binding protein, Syd-1 (Liprin, neurexin anchored)) and driven by conformational changes, by action potentials, to membrane fusion and thus to release
- synaptic cleft: Neurexin and Neuroligin bind to each other, vesicle diffusion to receptors at postsynapse
- postsynapse: glutamate receptors GLRII A + B (calcium-dependent); docking and fusion of vesicles, signal transmission; in NMJ contraction of muscle cells
116
What is Vectashield?
- medium for mounting
- to adjust diffraction index
- prevents dehydration and bleaching of the sample
117
What is an enhancer?
Transcriptional enhancers are DNA sequences that control expression of nearby genes and direct tissue-specific, positive regulation of these genes (Karo, 2002; Griffiths et al., 2002). Enhancers are often located 1kb or more from the target promoter and they might be upstream, downstream or even within the transcription unit they control.
118
What is the difference between T-maze and tully-wheel?
In a tully-wheel, odor-avoidance test and training can be performed simultaneously in 4 positions.
T-Maze only offers one position for tests.
119
How is the performance index calculated?
PI= [(CS-CS*)/(CS+CS*)]x100
120
Which value is usually expected for the odor avoidance score?
~ 30 – 40%
121
Which value is usually expected for the shock avoidance score?
> 90%
122
What does the N-terminus / C-terminus of BRP do? Where do you find this?
(Fragenkatalog)
N-terminus binds to presynaptic membrane. C-terminus collects and binds vesicles into the core region to provide them for vesicle release. N-terminus is surrounded by RIM-BP, binding around the Ca2+ channels of AZ in the presynapse. C-terminus protrudes into the synapse with overhanging terminus.
123
What is memory?
| Fragenkatalog
Process in which information is encoded, stored and retrieved. in Drosophila, untrained information and endogenous reactions/behaviour are retrieved in the lateral horn, the center of learning and memory is the mushroom body.
124
What is learning?
| Fragenkatalog
Change in behavior due to behaviour.
125
What is dicer (referring so RNAi)?
| Fragenkatalog
- an enzyme with an ATP-dependent RNA helicase domain that cuts dsRNA
- has a RNAse III motif
126
What is RISC?
| Fragenkatalog
- RNA-induced silencing complex
- argonaute protein
- RNAse H-like enzyme
- PAZ domain: si / mi RNA takeover
- PIWI domain: cuts down on target mRNA
127
How many chromosomes does Drosophila have? Which pair are the gonosomes?
How big is the genome compared to humans?
(Fragenkatalog)
- 4 chromosomes, the 4th is very small and not relevant for research
- 1st chromosome = gonosomes
- Drosophila has ~ 13,000 genes, humas have ~ 24,000 genes
128
What is habituation?
| Fragenkatalog
Decrease in response to a repeated stimulus not accombined by changes in other stimuli.
129
What is sensitization?
| Fragenkatalog
Increase in response to a moderate stimulus as a result of a strong exposure to a strong stimulus.
