Genetics

Question 1

Gene

Answer 1

A segment of DNA containing enough codons to produce all amino acids for one protein.
Example: ATTGACTACCGGTACGAATCG

Question 2

Beadle and Tatum’s One Gene-One Polypeptide Hypothesis:

Answer 2

Concluded that genes direct the production of only one enzyme.

Question 3

Vernon Ingram, One Gene-One Polypeptide Hypothesis:

Answer 3

Demonstrated the one gene-one polypeptide hypothesis by studying hemoglobin in individuals with sickle cell anemia. He concluded that a gene specifies the type and location of each amino acid in a polypeptide chain.

Examples: Hemophilia, cystic fibrosis.

Question 4

Codon

Answer 4

A sequence of three mRNA bases (e.g., AUG) that codes for a specific amino acid.

Question 5

Start Codon

Answer 5

AUG (signals translation start).

Question 6

Stop Codons

Answer 6

Signal translation stop.

Question 7

Triplet

Answer 7

A group of three nucleotides in DNA/RNA coding for an amino acid.

Question 8

Anticodon

Answer 8

A complementary trinucleotide sequence on tRNA corresponding to an mRNA codon.

Question 9

Amino Acid

Answer 9

Molecules that combine to form proteins.

Question 10

DNA

Answer 10

A double-stranded helix held together by hydrogen bonds between base pairs.

Question 11

Base Pairing (what pairs with what, and how?)

Answer 11

Adenine (A) pairs with Thymine (T) via 2 hydrogen bonds.

Cytosine (C) pairs with Guanine (G) via 3 hydrogen bonds.

Question 12

Nucleotides (3 components)

Answer 12

5-carbon sugar (deoxyribose).

Phosphate group (C5).

Nitrogenous bases: Pyrimidines (C, T) and Purines (A, G).

Question 13

Directionality

Answer 13

DNA is read 3’ → 5’ and synthesized 5’ → 3’.

3’ end: Hydroxyl group (-OH).

5’ end: Phosphate group.

Question 14

Frederick Griffith (1928)

Answer 14

Discovered bacterial transformation.

Question 15

Avery, MacLeod, McCarty (1944)

Answer 15

Identified DNA as the transforming principle.

Question 16

Hershey-Chase (1952)

Answer 16

Proved DNA is the hereditary material using bacteriophages.

Question 17

Erwin Chargaff (1950)

Answer 17

Developed Chargaff’s rules (A=T, C=G).

Question 18

Rosalind Franklin (1952)

Answer 18

X-ray diffraction revealed DNA’s double helix.

Question 19

Watson and Crick (1953)

Answer 19

Built the DNA double-helix model.

Question 20

Meselson-Stahl (1958)

Answer 20

Demonstrated semiconservative DNA replication

Question 21

DNA Replication: Key Steps

Answer 21

1. Unwinding the DNA
2. Priming
3. Elongation
4. Joining Fragments

Question 22

1. Unwinding the DNA
   Helicase -

Answer 22

Unzips the DNA.

Question 23

1.Unwinding the DNA
Topoisomerase -

Answer 23

Prevents overwinding.

Question 24

1. Unwinding the DNA
   SSBs -

Answer 24

Stabilize separated strands.

Question 25

2. Priming

Answer 25

RNA Primase: Lays down RNA primers.

Question 26

3. Elongation DNA Polymerase III

Answer 26

Synthesizes new strands (5’ → 3’).

Question 27

3. Elongation Leading Strand

Answer 27

Continuous synthesis.

Question 28

3. Elongation Lagging Strand

Answer 28

Discontinuous synthesis with Okazaki fragments.

Question 29

4. Joining Fragments DNA Ligase

Answer 29

Seals gaps

Question 30

Key Enzymes

Answer 30

Helicase, Topoisomerase, SSBs, RNA Primase, DNA Polymerase I/III, DNA Ligase.

Question 31

Protein Synthesis: 2 main steps

Answer 31

Transcription & Translation

Question 32

Where does transcription take place?

Answer 32

Nucleus

Question 33

Transcription steps

Answer 33

1. Initiation 2. Elongation 3. Termination

Question 34

Initiation

Answer 34

RNA polymerase binds to promoter regions (e.g., TATA box).

Question 35

Elongation

Answer 35

RNA polymerase synthesizes mRNA complementary to the template strand.

Question 36

Termination

Answer 36

RNA polymerase releases the mRNA transcript.

Question 37

Post-Transcriptional Modifications:

Answer 37

5’ Cap, 3’ Poly-A Tail: Stabilize mRNA. Splicing: Removes introns, joins exons.

Question 38

Where does translation occur?

Answer 38

Cytoplasm

Question 39

Steps of Translation?

Answer 39

1. Ribosomes bind mRNA at the start codon (AUG). 2. tRNA matches anticodons to mRNA codons, carrying amino acids. 3. Ribosome links amino acids with peptide bonds. 4. Process ends at stop codon.

Question 40

2 Main Types of Mutations?

Answer 40

1. Point Mutations 2. Frameshift Mutations.

Question 41

Types of Point Mutations

Answer 41

Silent, Missense, Nonsense

Question 42

Silent Mutation

Answer 42

No change in protein.

Question 43

Missense Mutation

Answer 43

Changes one amino acid.

Question 44

Nonsense Mutation

Answer 44

Introduces a stop codon.

Question 45

Framseshift Mutation:

Answer 45

Insertions/deletions alter the reading frame.

Question 46

What are Restriction Enzymes

Answer 46

Cut DNA at specific sites (sticky/blunt ends).

Question 47

What is Recombinant DNA?

Answer 47

Combines DNA from different sources.

Question 48

What are plasmids?

Answer 48

Circular DNA for gene insertion.

Question 49

What is Gel Electrophoresis?

Answer 49

Separates DNA by size

Question 50

What is PCR?

Answer 50

Amplifies DNA

Question 51

What is CRISPR-Cas9?

Answer 51

Precise gene editing

Question 52

Gene Control In Prokaryotes

Answer 52

Lac Operon: Induced by lactose to digest the sugar. Trp Operon: Repressed by tryptophan to stop its production.

Question 53

Gene control is eukaryotes

Answer 53

mRNA Processing: Introns removed, exons joined. Alternative Splicing: Produces multiple proteins from one gene.