Last Minute

Question 1

A bacterial strain lacking the RecA protein will be

Answer 1

unable to perform generalized recombination

RecA is involved in generalized recombination. Phase variation is an example of site-specific recombination, which does not require RecA.

Question 2

A mutation always results in

Answer 2

change in genotype

Any change to the DNA sequence results in a change in the genome. Mutations may be beneficial or neutral. A neutral or silent mutation may not affect the phenotype.

Question 3

An insertion sequence contains a gene for this enzyme

Answer 3

Transposase

An insertion sequence (IS) is a simple transposable element that consists of a transposase gene flanked by short, inverted repeats that are the target of transposase.

Question 4

Avery, MacLeod, and MacCarthy performed landmark experiments showing transformation in which bacterium?

Answer 4

Streptococcus pneumoniae

Studies identifying transformation were performed in the 1940s using Streptococcus pneumoniae.

Question 5

Bacteria may donate DNA to

Answer 5

other bacteria of the same or of a different species, some eukaryotic cells, and bacteriophages.

Bacteria can donate DNA to a wide variety of other cells and also viruses. For example, the bacterium Agrobacterium tumefaciens can transfer DNA into plants and phages can acquire bacterial DNA during infection.

Question 6

Based on gel electrophoresis, a nonfunctional protein is found to have a smaller molecular weight than its wild-type counterpart. A likely explanation for this observation is a

Answer 6

nonsense mutation in the DNA coding for the
protein

A nonsense mutation causes a premature stop codon, shortening the protein and lowering its molecular weight. A silent mutation does not change sthe amino acid sequence of the protein. A missense mutation, which replaces one amino acid with another, is unlikely to have a large effect on protein molecular weight. A duplication of the DNA may change the amount of protein being produced, but not its molecular weight.

Question 7

DNA encoding for which capability is part of the flexible gene pool?

Answer 7

Antibiotic resistance

Not all organisms need to contain the genes encoding resistance to specific antibiotics. Genes encoding enzymes involved in DNA replication, ribosome synthesis, and cell membrane synthesis are part of the core gene pool, which consists of genes needed by organisms for independent growth and replication.

Question 8

During DNA synthesis, if DNA polymerase incorporates a wrong nucleotide,

Answer 8

methyl mismatch repair will correct the unmethylated daughter strand to match the methylated template strand.

DNA polymerase is very accurate, but not 100% accurate. Methyl mismatch repair may catch and fix mistakes. The parent strand is methylated and the newly synthesized daughter strand is at first unmethylated, so the unmethylated strand gets repaired.

Question 9

Horizontal gene transfer can occur via

Answer 9

Conjugation, transformation, and transduction can all lead to horizontal gene transfer.

Question 10

If a bacterial cell is competent, it means that

Answer 10

the bacterium can import free DNA fragments and incorporate them into its genome

Competence refers to the ability to perform transformation.

Question 11

If a bacterial cell is missing AP endonuclease genes, which of the following could NOT occur

Answer 11

Base excision repair

AP endonucleases are used during base excision repair, after a glycosylase removes a damaged base, forming an AP site.

Question 12

If a cytosine deaminates and becomes a uracil, which enzyme will cleave the uracil from the DNA backbone in the first step of a repair process?

Answer 12

Glycosylase

Glycosylases remove damaged or wrong bases from the phosphodiester backbone in an early step of base excision repair.

Question 13

In generalized recombination, which protein complex is responsible for homology searching?

Answer 13

RecA

During generalized recombination, the RecA protein complex finds homology and mediates strand invasion.

Question 14

In the basic Ames test for mutagenesis, a mutagen is tested to see if it can

Answer 14

produce colonies on basic medium that lacks
histidine, starting with a hisG mutant strain of bacteria

The Ames test is a reversion test, meaning that the mutagen is tested to see if it can restore the ability to synthesize histidine to hisG mutant bacteria.

Question 15

One sign of horizontal gene transfer is

Answer 15

GC base ratio different from flanking chromosomal DNA

Each type of microorganism has particular GC ratios. Regions of the genome with highly different ratios may be example of genes acquired via horizontal transfer. Uniform codon usage argues against horizontal gene transfer. Gene duplication may occur during replication, but this is not a form of horizontal gene transfer. Gene loss may lead to pathogenicity, but gene loss is not horizontal gene transfer.

Question 16

Over time, the genome of a species

Answer 16

may change due to mutation or gene swapping

Over time, genomes change due to a variety of different mechanisms. Harmful mutations will not persist in a population and although whole genomes may double, this is a rare event.

Question 17

Pathogenicity islands (PAIs) are often found integrated near

Answer 17

tRNA genes

The tRNA genes often serve as sites of PAI integration.

Question 18

Replicative transposition differs from nonreplicative transposition in that

Answer 18

only replicative transposition results in the insertion sequence appearing in new host DNA, while still remaining in the original DNA site

The term “replicative” refers to whether the DNA element is replicated (replicative) or excised and moved (non replicative).

Question 19

Site-specific recombination

Answer 19

needs very little sequence homology between the donor and recipient DNA

Unlike generalized recombination, which requires RecA and large regions of sequence homology, site-specific recombination requires only minimal regions of homology.

Question 20

The enzyme photolyase repairs DNA damage caused by

Answer 20

UV radiation

Question 21

The mutation rate in a wild-type E. coli cell is on the order
of

Answer 21

10^–9 per base pair replicated

The mutation rate in a cell is approximately 10^–9 to 10^–10 per base pair replicated.

Question 22

The process of importing free DNA from the environment into cells is called

Answer 22

transformation

Transformation is the uptake of DNA from the environment. Conjugation requires cell-cell contact, transduction is mediated through a bacteriophage, and transcription is the production of an RNA complementary to a DNA template.

Question 23

The relaxase enzyme, used during conjugation, has which enzymatic activity?

Answer 23

Endonuclease

Relaxase nicks the phosphodiester backbone at oriT site on the fertility factor prior to transfer of a single strand into the recipient cell.

Question 24

Transduction is an example of

Answer 24

horizontal gene transfer

Transduction, the acquisition of a gene from a bacteriophage, is an example of horizontal gene transfer. It does not imply gene duplication, although this may occur. Vertical gene transfer occurs during cellular DNA replication and cell division.

Question 25

Transposable elements differ from plasmids in that only plasmids

Answer 25

may exist autonomously, not integrated into host DNA Transposable elements may "jump" from one DNA molecule to another, but they do not replicate independently as plasmids can. Both plasmids and transposable elements are comprised of dsDNA and both may code for antibiotic resistance. Conjugative transposons may be transmitted horizontally.

Question 26

Uptake of foreign DNA into a bacterium

Answer 26

may help or harm the bacterium Bacteria can take up foreign DNA via transformation, conjugation, or transduction. Uptake of foreign DNA may be harmful or helpful depending on what the DNA codes for. For example, uptake of genes that encode useless products drain energy from the bacterium, whereas some plasmids can confer antibiotic resistance, which can be helpful if the bacterium is exposed to that particular antibiotic.

Question 27

Purines such as guanine are susceptible to spontaneous hydrolysis of the glycosidic bond connecting the base to the sugar backbone. This leads to an apurinic site in a process known as

Answer 27

depurination

Question 28

Which function do bacterial pheromones promote?

Answer 28

Conjugation Pheromones are signaling molecules that help facilitate "bacterial sex," also known as conjugation.

Question 29

Which of the following can cause mutations?

Answer 29

Chemical mutagens, UV radiation and spontaneous mutations during DNA replication

Question 30

Which of the following DNA repair mechanisms is error prone?

Answer 30

SOS repair SOS repair, which is error prone, only occurs during extreme DNA damage. Methyl mismatch repair, nucleotide excision repair, and photoreactivation are error proof.

Question 31

Which of the following enzymes is used in methyl mismatch repair, nucleotide excision repair, and base excision repair?

Answer 31

DNA polymerase I DNA polymerase I is used to synthesize new, correct DNA in all of the repair mechanisms listed. The other enzymes are specific to certain types of repair mechanisms.

Question 32

Which of the following is a laboratory technique for inducing transformation?

Answer 32

Electroporation Electroporation makes the membrane temporarily permeable to DNA so researcher-supplied DNA can be taken into bacterial cells. The translocasome is involved in natural transformation. Conjugation via sex pili is not a lab technique.

Question 33

Which of the following is a mutation?

Answer 33

A harmful deletion of part of an organism’s DNA A single base change that enhances fitness A change in the DNA that does not change protein structure

Question 34

Which type of DNA uptake is dependent on transferable plasmids?

Answer 34

Conjugation A transferable plasmid is needed when one cell directly transfers DNA to another cell as occurs in conjugation. Transformation, the uptake of DNA from the environment, and transduction, the acquisition of a gene from a bacteriophage, do not require a transferable plasmid.

Question 35

Which type of DNA uptake is dependent on viruses?

Answer 35

Transduction Transduction requires bacteriophages, viruses that infect bacteria, to transfer DNA. Conjugation, the direct transfer of DNA from one bacterial cell to another, and transformation, the uptake of DNA from the environment, do not rely on viruses.

Question 36

A DNA microchip, scanned with cDNAs, can give information about

Answer 36

the transcription of specific genes Scanning a DNA microchip with cDNAs prepared from mRNAs can give information about which mRNAs were present in the cell.

Question 37

Accumulation of the heat-shock sigma factor, sigma H, increases at high temperatures because

Answer 37

at high temperatures sigma H mRNA adopts an unfolded secondary structure At normal temperatures the sigma H mRNA adopts a folded secondary structure that hides the ribosome binding site limiting translation. At higher temperatures this secondary structure is lost and the ribosome binding site becomes available.

Question 38

Acyl homoserine lactone produced by luxI of Allivibrio fisherii is an example of

Answer 38

an autoinducer Acyl homoserine lactone is an autoinducer. High environmental concentrations of the autoinducer lead to transcription of the lux operon, production of luciferase, and bioluminescence.

Question 39

An inducer causes gene expression by binding

Answer 39

a repressor protein to remove it from the DNA Inducers activate gene transcription by binding a repressor protein and removing the inhibitory repressor from DNA.

Question 40

Anti-anti-sigma factors

Answer 40

bind anti-sigma factors, releasing sigma factors to activate transcription Anti-anti-sigma factors allow sigma factors to work by binding and inhibiting anti-sigma factors.

Question 41

AraC is one of a large family of AraC-like proteins. What do all these proteins have in common?

Answer 41

They all contain a high degree of homology to AraC and XylS The AraC-like proteins all contain two helix-turn-helix DNA-binding motifs, although these recognize different consensus sequences. They are not homologous in the ligand-binding domain.

Question 42

During Bacillus and Clostridium sporulation, transcription is controlled in two different compartments beginning with the use of sigma F. The activity of sigma F is controlled by

Answer 42

anti-anti-sigma factors and anti-sigma factors Sigma F activity is turned on and regulated via anti-sigma and anti-anti-sigma factors and it is degraded by ClpPC protease.

Question 43

During phase variation there is

Answer 43

a rearrangement of an organism’s DNA Phase variation, which changes the amino acid sequence of a protein from one antigenic type to another, involves an alteration in the DNA sequence, often a site-specific recombination that flips a DNA sequence in a chromosome.

Question 44

Enzyme activity can be most rapidly changed at which level?

Answer 44

Posttranslational modification of the enzyme A posttranslational modification to a preexisting protein is the fastest way to change enzyme activity.

Question 45

Guanosine tetraphosphate (ppGpp) serves as a signal to the cell that

Answer 45

ribosome synthesis should be curtailed During poor nutrient conditions, ppGpp accumulates to curtail rRNA and tRNA synthesis. This is known as the stringent response.

Question 46

In attenuation occurring at the trp operon, when will the ribosome pause at the leader sequence?

Answer 46

When tryptophan levels are low The ribosome will pause at the tryptophan codons in the leader sequence under low cell tryptophan levels, when few trp-charged tRNAs are present.

Question 47

One advantage to using sRNAs to control protein expression is that

Answer 47

translation of the sRNA is not needed, thus saving amino acids Because sRNA acts as an RNA and does not need to be translated into protein, it may act more quickly, with less cell energy expenditure. The sRNA does need to be transcribed from DNA and the sRNA will only recognize specific target molecules.

Question 48

Proteins are separated based on electric charge differences during

Answer 48

isoelectric focusing gel electrophoresis During isoelectric focusing proteins in a cell extract are sorted according to their individual charges determined by ionizable amino and carboxyl side groups. SDS- poly acrylamide gel electrophoresis separates proteins based on molecular weight. Electron microscopy is a technique to view subcellular particles. Centrifugation separates cell components based on density, not charge.

Question 49

Quorum sensing may be involved in which of the following processes?

Answer 49

Bacterial luciferase expression Control of bacterial virulence genes Nitrogen-fixing bacterial symbiosis with plants

Question 50

Some sRNAs are responsible for

Answer 50

regulating protein levels at the level of translation Many sRNA (small untranslated RNAs) are involved in regulating protein levels. The rRNAs form part of the ribosome and tRNAs are charged with amino acids.

Question 51

The AraC-like regulators differ from the LacI repressor in that

Answer 51

only the AraC-like regulators can activate transcription by direct interactions with RNA polymerase The LacI repressor simply comes off DNA in the presence of allolactose, thereby relieving inhibition, whereas AraC-like regulators can actively stimulate transcription by interacting with RNA polymerase.

Question 52

The cAMP receptor protein (CRP) has binding sites for

Answer 52

the RNA polymerase alpha subunit After being bound by cAMP and binding to specific DNA sequences, cAMP-CRP can interact with RNA polymerase to enhance transcription.

Question 53

The DNA sequence 5'-ATCGATCGnnnnnnnnnnCGATCGAT-3' is an example of

Answer 53

an inverted repeat An inverted repeat is a sequence found in identical (but inverted) forms at two sites on the same double helix. A direct repeat is a sequence found in identical form at two sites on the same double helix (e.g., 5'-ATCGATCGnnnnnATCGATCG-3'). A tandem repeat is a direct repeat without any intervening DNA sequence (e.g., ATCGATCGATCGATCGATCGATCG).

Question 54

The lac operon includes which three proteins?

Answer 54

Lactose permease, beta-galactosidase, and thiogalactoside transacetylase The lac operon contains three genes—lacZ, lacY, and lacA—that encode beta-galactosidase, lactose permease, and thiogalactoside transacetylase, respectively.

Question 55

The lac operon will be maximally transcribed when

Answer 55

lactose is present but glucose is not The lac operon is maximally transcribed when lactose is present as an inducer and glucose is absent to allow binding of cAMP receptor protein (CRP).

Question 56

The protein product of the lacI gene is

Answer 56

a regulatory protein The LacI protein is a repressor, a type of regulatory protein.

Question 57

The proteome refers to the

Answer 57

complement of proteins present at a particular point in time The proteome refers to protein expression patterns. The complement of RNAs is called the transcriptome. The complete set of ORFs simply indicates the number of protein-coding genes but does not describe which ORFs are being transcribed and translated under a given set of conditions.

Question 58

The stringent response

Answer 58

occurs in response to low energy stores The stringent response is a cellular response to idle ribosomes (often indicating low carbon and energy stores) that includes a decrease in rRNA and tRNA production.

Question 59

The trp operon is regulated by

Answer 59

both a repressor protein and attenuation The trp operon has multiple levels of regulation. Both a repressor protein and transcriptional attenuation ensure that the structural genes are only transcribed when tryptophan levels are low.

Question 60

To get maximal expression of the lac operon, low glucose is

Answer 60

necessary but not sufficient Although low glucose is needed, the presence of lactose is also required.

Question 61

What functional group do kinases transfer to other molecules?

Answer 61

Phosphate Kinases phosphorylate other molecules by attaching a phosphate group.

Question 62

When sensing and responding to chemicals, the "key?" protein, CheA, works by

Answer 62

lowering CheA activity in the presence of a chemoattractant, which leads to lower CheY-P levels and thus allows for longer runs CheA is a kinase that will phosphorylate CheY. CheY-P results in higher tumbles. When CheA has lowered activity, CheY is not as phorphrylated and thus, there will be longer runs toward the chemical.

Question 63

Which mechanism sets the levels of a particular protein in the cell?

Answer 63

Transcription of DNA into mRNA Stability of mRNA transcripts Translation of mRNA into protein

Question 64

Which of the following is composed of DNA?

Answer 64

An operator An operator is a regulatory DNA sequence. Sensor kinases and regulators are proteins. An inducer is a small metabolite that binds to a regulatory protein.

Question 65

Which of the following is LEAST subject to change in the cell?

Answer 65

Genome Although the genome is subject to phase variation, it is the most stable of the omes. The transcriptome changes as different genes are expressed. The proteome changes frequently as different genes are transcribed and translated.

Question 66

Which of the following may indicate a DNA site that binds a regulatory protein?

Answer 66

The DNA contains an inverted repeat Regulatory proteins often function as dimers, which each monomer binding one-half of an inverted repeat.

Question 67

When glucose is present, enzyme IIA^glc is not phosphorylated and LacY is inhibited.

Answer 67

The ability of the phosphotransferase system to regulate LacY is known as inducer exclusion. When glucose is present, IIA^glc is not phosphorylated, as it donates its phosphate to glucose. The unphosphorylated IIA^glc inhibits LacY, preventing lactose uptake.

Question 68

Which researchers won a Nobel Prize for discovering that genes can be induced?

Answer 68

Jacob and Monod Jacob and Monod proposed gene regulation in 1961, and along with Lwoff, won the Nobel Prize in Physiology and Medicine in 1965.

Question 69

Which technique can analyze proteome patterns?

Answer 69

Two-dimensional gel electrophoresis Two-dimensional gel electrophoresis can be used to separate proteins. DNA microchip arrays give information about the transcriptome. Polymerase chain reaction is a technique to amplify specific DNA sequences. Enrichment culture is used to grow specific populations of bacteria.

Question 70

A segmented viral genome

Answer 70

can facilitate rapid evolution of new viral strains Since segmented genomes are composed of multiple nucleic acids strands, coinfection with two viral strains can lead to swapping of segments, which may speed up evolution.

Question 71

Compared to bacteriophages, animal viruses usually have an easier time entering cells because

Answer 71

animal cells lack a cell wall The cell wall of bacteria poses problems for phage entry. Animal cells lack a cell wall and thus may ease viral entry. Animal viruses still contact specific membrane proteins to enter.

Question 72

Hepatitis C virus (HCV) is primarily acquired through

Answer 72

blood transfusion HCV is known to cause liver cancer and cirrhosis and it is mainly transmitted by means of blood transfusions and injectable drug usage.

Question 73

Herpes simplex virus (HSV) causes latent infection in the region of the

Answer 73

neurons of the ganglia The primary infection caused by HSV is epithelial in nature. However, it is followed by latent infection within the neurons of the ganglia and in particular the common site of infection is the trigeminal ganglion.

Question 74

Herpes simplex virus (HSV) encodes a proofreading endonuclease that works during viral replication. From this, what can we reasonably predict?

Answer 74

The viral mutation rate is relatively low Proofreading activity implies a low mutation rate. The presence of a viral enzyme implies nothing about whether the host cell can have its own endonuclease. HSV is a double-stranded DNA virus that has a latent phase.

Question 75

Herpes simplex virus (HSV) infects which of the following cell types?

Answer 75

Epithelial cells Ganglial neural cells

Question 76

One reason it is difficult to develop a vaccine for AIDS is because

Answer 76

HIV has a high mutation rate Due to the high error rate of reverse transcriptase, HIV envelope proteins change frequently. This makes vaccine development difficult.

Question 77

Phage T4 protects its genome from cleavage by host restriction endonucleases by

Answer 77

modification of cytosines, via hydroxymethylation, in its own genome A viral enzyme replaces cytosines throughout the phage chromosome with the modified base 5-hydroxymethylcytosine. Restriction endonucleases will not recognize the modified cytosine bases.

Question 78

Retroelements are

Answer 78

decaying retroviral genomes in a host genome Retroelements are decaying retroviral genomes in a host genome.

Question 79

Temperature-sensitive mutations

Answer 79

isplay a mutant phenotype at one temperature but not another Temperature-sensitive mutations are conditional mutations, displaying the mutant phenotype under one environmental condition but not another. Premature stop codons will likely lead to defective proteins regardless of the temperature and temperature-sensitive mutations can be obtained in prokaryotes and viruses.

Question 80

The 5' internal ribosome entry site (IRES) is present in the genome of

Answer 80

Hepatitis C virus (HCV) IRES segment is present in the genome of HCV. It contains numerous stem loop structures and initiates translation in the host cell.

Question 81

The causative agent of acquired immune deficiency syndrome is

Answer 81

Human immunodeficiency virus (HIV) Human immunodeficiency virus (HIV) is the causative agent of AIDS.

Question 82

The envelope proteins E1 and E2 of Hepatitis C virus (HCV) form dimers, which are

Answer 82

club shaped E1 and E2 are the main envelope proteins that make up the virion. They form a club-shaped dimer structure on the outer surface of the envelope.

Question 83

The following HIV encoded enzymes work in which temporal sequence during an HIV infection?

Answer 83

Reverse transcriptase, integrase, protease A DNA copy of the viral genome is first produced by reverse transcriptase, then integrase inserts the viral genome into the host cell DNA. Finally, viral proteins can be produced and cleaved by protease.

Question 84

The HIV drug azidothymidine (AZT) has what mechanism of action?

Answer 84

It is a reverse transcriptase inhibitor AZT is a nucleotide analog that inhibits reverse transcriptase.

Question 85

The phage T4 infects

Answer 85

certain E. coli strains T4 infects E. coli containing the porin OmpC in their outer membrane.

Question 86

The T4 phage genome contains about how many genes?

Answer 86

170 The 166 kilobase T4 genome specifies 170 genes, many of which encode metabolic enzymes that replace host cell functions.

Question 87

The three-dimensional structure of the polyhedral T4 phage was determined in part by

Answer 87

X-ray analysis X-ray crystallography can be used to determine structures. Restriction enzymes cut specific DNA sequences, PCR is used to amplify specific DNA sequences, and two-dimensional gel electrophoresis is used to separate proteins.

Question 88

Viruses that are effective gene therapy vectors should

Answer 88

have virulence genes removed Viruses that are effective gene therapy vectors should have virulence genes removed to avoid patient illness. Promotion of an immune response, integration near an oncogene, and transmission to the germ line should all be avoided.

Question 89

What causes influenza virus hemagglutinin to undergo a structural change that mediates viral envelope fusion with host membranes and viral uncoating?

Answer 89

Low pH inside lysosomes When hemagglutinin is exposed to the low pH inside the lysosome, it triggers conformational changes that allow a fusion peptide to penetrate the lysosomal membrane. This leads to viral uncoating and the release of the viral genome into the cytoplasm.

Question 90

What would happen to an HIV virion that did not include reverse transcriptase due to a packaging error?

Answer 90

It would probably be able to enter cells, but would not replicate its genome Without reverse transcriptase (RT), the virus has no way to produce the double-stranded DNA needed for viral replication. If the HIV envelope glycoproteins are intact, it can enter new cells. RT is not needed for HIV fusion with host cells.

Question 91

Which among the following viruses is the leading cause of mortality in outdoor cats in the United States?

Answer 91

Feline leukemia virus Feline leukemia virus is a major veterinary pathogen that is responsible for killing outdoor cats in the United States. Despite the availability of vaccine, it remains the number one killer.

Question 92

Which enzyme transcribes the integrated HIV genome?

Answer 92

Host RNA polymerase Transcription involves making an RNA copy from a DNA template. RNA polymerase catalyzes this reaction. HIV does not have its own RNA polymerase; it relies on the host polymerase.

Question 93

Which HIV envelope protein is necessary for host cell entry?

Answer 93

SU SU is an envelope protein that initially makes contact with the host cell CD4 protein.

Question 94

Which HIV open reading frame codes for enzymes?

Answer 94

pol The pol open reading frame codes for three enzymes; integrase, RT, and protease. The gag sequence encodes capsid and nucleocapsid proteins and env encodes envelope proteins.

Question 95

Which HIV open reading frame encodes the SU and TM spike proteins?

Answer 95

env The SU (surface) and TM (transmembrane) proteins form spike proteins that peg the envelope. They are encoded by the env open reading frame.

Question 96

Which is true of influenza virus entry into a cell?

Answer 96

HA in the viral envelope contacts sialic acid containing proteins in the host membrane. Hemagglutinin in the viral envelope initially makes contact with sialic acid-containing glycoproteins on the host cell membrane. The virus then undergoes endocytosis and lysosomal fusion.

Question 97

Which of the following enzymes is a potential anti-HIV drug target?

Answer 97

Integrase Protease Reverse transcriptase

Question 98

Which of the following is an enzymatic activity of reverse transcriptase?

Answer 98

DNA synthesis from a DNA template RT can synthesize DNA from a DNA or an RNA template.

Question 99

Which of the following is one of the two proteins of tight junction to which Hepatitis C virus (HCV) binds?

Answer 99

Claudin-1 Claudin-1 and occludinare the two proteins that form a part of the tight junction to which HCV binds and enters into the host cell.

Question 100

Lentiviruses are a type of retrovirus

Answer 100

Lentiviruses (such as HIV) are a type of retrovirus, a virus with a single-stranded RNA genome that uses reverse transcriptase to form a double-stranded DNA.

Question 101

Which of the following statements correctly identifies some differences between H5N1 avian influenza and human influenza A?

Answer 101

Human influenza A recognizes carbohydrates found in the upper respiratory tract, whereas H5N1 avian influenza only binds carbohydrates deep in the lungs Human influenza A and H5N1 avian influenza recognize different sialic acid-linked carbohydrates. The carbohydrates recognized by human influenza A are found in the upper respiratory tract, whereas those recognized by H5N1 avian influenza are found deep in the respiratory tract.

Question 102

The influenza envelope proteins are initially synthesized in the endoplasmic reticulum for eventual transport to the cell membrane

Answer 102

The influenza envelope proteins ultimately need to be transported to the cell membrane. In eukaryotic cells, cell membrane–bound proteins pass through the endomembrane system consisting of the endoplasmic reticulum (ER) and Golgi.

Question 103

Which of the following viruses contains a DNA genome?

Answer 103

Herpes simplex virus Herpes simplex virus is a DNA virus. All the other viruses listed contain different kinds of RNA genomes.

Question 104

Which of the steps listed is the earliest in the replicative cycle of phage T4?

Answer 104

Phage DNA undergoes rolling-circle replication Of the steps listed, phage replication comes first. After this, late genes are expressed to make head and tail components, genomes are packaged into heads, and heads are assembled onto tails. Lysis of the cell and release of new viral particles is the last step.