Potential Questions

Question 1

Which of the following statements about DNA structure is correct

Answer 1

DNA strands run anti-parallel to each other

Question 2

How are nucleotides in a DNA strand connected?

Answer 2

By phosphodiester bonds

Question 3

If a DNA strand sample contain 30% adenine, what percentage of thymine does it contain

Answer 3

30%

Question 4

What is genome?

Answer 4

The entire set of genetic material in an organism

Question 5

What type of sugar is found in DNA?

Answer 5

Deoxyribose

Question 6

What is the structural difference between DNA and RNA

Answer 6

DNA contains deoxyribose, while RNA contains ribose

Question 7

Which of the following is true about the structure of nucleosome?

Answer 7

It consists of 8 histone proteins

Question 8

True or False: the phosphodiester bonds in DNA connect the 5’ phosphate of one nucleotide to the 3’ hydroxyol of another nucleotide

Answer 8

True

Question 9

True or False: Euchromatin is loosely packed DNA and is transcriptionally active

Answer 9

True

Question 10

Nucleosome are made up of _____ histones and can package approximately ______ base pairs of DNA, including both wrapped DNA and linker DNA

Answer 10

8 , 200

Question 11

What is the role of the sigma factor in bacterial transcription

Answer 11

Helps RNA polymerase bind to the promoter

Question 12

What is the pribnow box?

Answer 12

A conserved DNA sequence in bacterial promoters

Question 13

Which mechanism is involved in bacteria transcription termination

Answer 13

Rho-dependent or intrinsic termination

Question 14

Which DNA sequence is important for transcription initiation in eukaryotes and is what TFII2 too?

Answer 14

TATA box

Question 15

What modification is added to the 5’ end of eukaryotic mRNA?

Answer 15

7-methlguanosine cap

Question 16

What are introns

Answer 16

Non-coding sequences removed during RNA splicing

Question 17

Alternative splicing of introns and extrinsic allows for

Answer 17

A single gene to produce multiple proteins

Question 18

What sequence signals transcription termination in eukaryotes

Answer 18

Polyadenylation signal (AAUAAA)

Question 19

If this is codoning sequence of DNA, what mRNA would be produced from it
-ATTCTGCATC

Answer 19

AUUCUGCAUC
-only changing T to U

Question 20

Which of the following is not required for eukaryotic transcription but is essential in prokaryotic transcription

Answer 20

Sigma factor

Question 21

Why do eukaryotic mRNAs undergo post-transcriptional modifications

Answer 21

All of the above

Question 22

What is a key difference between prokaryotic and eukaryotic transcription termination

Answer 22

Eukaryotes used a polyadenylation signal, while prokaryotes use Rho-dependent or intrinsic termination

Question 23

Why do eukaryotic mRNAs require a 5’ cap and poly-A tail?

Answer 23

All of the above

Question 24

Which of the following is a key difference in gene expression between eukaryotes and prokaryotes

Answer 24

Eukaryotic genes have introns, while prokaryotic genes do not

Question 25

In eukaryotes, transcription occurs in the ______, while in prokaryotes, it occurs in the ________.

Answer 25

Nucleus, cytoplasm

Question 26

What is the role of tRNA in translation?

Answer 26

It carries amino acids to the ribosome

Question 27

In eukaryotic translation, what structure help ribosomes recognize the mRNA?

Answer 27

5’ cap (7-methylguanosine)

Question 28

Which site in the ribosome holds the growing polypeptide chain?

Answer 28

P Site

Question 29

What is the first step in translation initiation

Answer 29

The small ribosomal subunit binds to mRNA

Question 30

Which site in the ribosomes holds the growing polypeptide chain?

Answer 30

P site

Question 31

What is the first step in translation initiation

Answer 31

The smalls ribosomal subunit binds to mRNA

Question 32

How is the genetic code read during translation?

Answer 32

In set of three nucleotides

Question 33

What amino acid does the start codon (AUG) code for?

Answer 33

Methionine

Question 34

What amino acid chain is made from the following mRNA - AAAACCGAUGUUUGAGGGGAAA

Answer 34

Met-phe-glu-gly-lys

Question 35

True or false: The poly-A tail no role in translation

Answer 35

True

Question 36

True or False stope condones have corresponding amino acids just like all the other codons

Answer 36

False

Question 37

Proteins job/function is determine by the proteins

Answer 37

Shape