QUIZ 1 Flashcards
(9 cards)
A slash (/) separates genes and their alleles that are on…
homologous chromosomes
A semicolon (;) separates genes and their alleles that are on…
non-homologous chromosomes
A diploid organism is homozygous for 3 genes and heterozygous for 6 genes. All 9 genes are on diff chromosomes. How many different genotypes would you expect among the gametes produced by that organism? Put a number in the box
64
A mother heterozygous for recessive mutant alleles of the a and B genes and a father homozygous for dominant alleles of the A and B genes have an offspring with genotype A/a/a; B/b. When did nondisjunction occur?
in the father at meiosis II
From Question 5, the A/a/a;B/b offpsring is..
trisomic
An embryo inherit t and B alleles from the sperm, and inherits T and b alleles from the oocyte. The T and B genes are on different chromosomes. correctly write the genotype of the embryo.
T/t; B/b
Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. Is this a test cross?
true
Using the letter A for one gene and the letter B for the second gene, write the genotypes (using ; and / symbols) of a cross between a dihybrid and a fully recessive individual. What proportion of the offspring of the above cross do you expect to show the fully recessive phenotype?
1/4
The sequence below shows the coding sequence of a gene that encodes a small protein
ATGCACTCCGGATACCATGATTTTGGATAA
How many amino acids are in the small protein encoded by this gene? Enter a number in the box provided.
9 (TAA is a STOP codon)