Quiz 14 - A prescription for Translation Flashcards Preview

Genetics 3063 > Quiz 14 - A prescription for Translation > Flashcards

Flashcards in Quiz 14 - A prescription for Translation Deck (20):
1

DNA is _________ into RNA which is ________ into protien

transcribed; translated

2

According to the central dogma of molecular biology, which of the following is a forbidden direction for the transfer of genetic information?
RNA → DNA
RNA → RNA
DNA → RNA
protein → RNA
choose this answer if all of the above are possible

protein → RNA is forbidden

3

In eukaryotes, RNA pol ____ transcribes mRNA.

RNA Pol II

4

In eukaryotes, RNA pol ____ transcribes tRNA.

RNA Pol III

5

Eukaryotic mRNA is ________cistronic while bacterial mRNA is is ______cistronic

Eukaryotic mRNA = monocistronic
Bacterial mRNA = polycistronic

6

Eukaryotic mRNA and bacterial mRNA are short or long-lived

Eukaryotic mRNA = long lived
Bacterial mRNA = short lived

7

The two types of transcription terminators in Escherichia coli are termed what?

Rho-dependent and Rho-independent

8

Exclusion of intervening sequences are included in ____-________ ________ of eukaryotic mRNA

post-transcriptional modifications

9

RNA editing of eukaryotic mRNAs primarily involves
- adenines
- cytosines
- guanines
- thymines
- uracils

Uracils

RNA editing of eukaryotic mRNAs primarily involves Uracil

10

Which of the following statements about the E. coli RNA polymerase holoenzyme is TRUE?

-it does not require a primer for initiating RNA synthesis
- it is composed of the subunits a2bb's ( it's suppose to be alpha beta bate sigma)
- Both A and B
- neither A nor B

Both A and B

11

Consider the following DNA molecule:
5' TTCCCATTTCGATGGGATACGATGGGCTTATGTGAAAATTTGGGG 3'
3' AAGGGTAAAGCTACCCTATGCTACCCGAATACACTTTTAAACCCC 5'

What is the sequence of the transcribed mRNA, assuming transcription proceeds left to right?

5' UUCCCAUUUCGAUGGGAUACGAUGGGCUUAUGUGAAAAUUUGGGG 3'

12

True or False. In any given region of eukaryotic DNA, only one strand can act as the coding strand of a gene

True

13

True or False. Alternative splicing of a single pre-mRNA may yield different mRNA species that code for different polypeptides

True

14

The following DNA fragment is being transcribed by RNA polymerase.
5’ ATTGCC 3’
3’ TAACGG 5’


What is the sequence of transcribed RNA, if the top strand is the noncoding strand?
5’ AUUGCC 3’
5’ UAAGCC 3’
5’ GCCAAU 3’
5’ CCGUUA 3’

none of the above

None of the above

15

The cap on mRNA consists of a ____________ attached to the ___ end

7-methylguanosine attached to the 5' end

16

For a given gene, the coding strand of DNA is complementary to ?

The template DNA strand

17

During transcription initiation in bacteria, the promoter is recognized by what?

The sigma factor

18

Reverse transcriptase synthesize _____ that is complementary to an ________

DNA; RNA template

19

Which of the following code for amino acids?
Intron
Ion
Exon
Exxon
Enron

Exon

20

The point of transcription termination is said to be ______ from the promoter.

upstream
down stream

Downstream