RNA + Protein Synthesis Flashcards
(15 cards)
What is RNA?
stands for RIBOnucleic acid
What are the 3 differences between DNA and RNA?
- DNA is a shaped into a double helix so it has double strands of nucleotides whereas RNA is a single strand of nucleotides
- DNA Is “DEOXY”ribonucleic acid and RNA is ribonucleic acid – DNA uses dexoyribose sugar and RNA uses ribose sugar in its strucutre
- The nucleotides for DNA is A,T,G,C but there is no T in RNA – instead there is URACIL (U)
look at this strand of nucleotides – is this RNA or DNA?
ATGCTACGGGGGCCAAATCGC
DNA
look at this strand of nucleotides – is this RNA or DNA?
AGCGCAAUUCCCGUACG
RNA
What is the role of RNA in protein synthesis?
The order of nucleobases in an mRNA strand (messenger RNA) correlate to a specifc sequences on tRNA (transfer RNA) which hold amino acids. As mRNA and tRNA join together, the amino acids of the tRNA bond together to form a polypeptide chain. mRNA is used as the instruction manual for how to assemble the amino acid order in order to create that specific protein
there are three type of RNA? what are the types, their location, their function?
- mRNA – made in nucleus, moves to cytoplasm – function is TRANSCRIPTION
- tRNA – made in nucleus, moves to cytoplasm – function is TRANSLATION
- rRNA – part of the ribosome – helps in assembly of proteins because it is a structural part of ribosomes
Where are proteins ASSEMBLED in the cell? (by which organelle)
RIBOSOMES ARE THE LOCATION OF PROTEIN ASSEMBLY
What do we mean by transcription when we think about mRNA’s function?
Transcription means to COPY
mRNA is a copy of one of the DNA strands
If you have a DNA strand that looks like:
ATTGGCGCTAAT
what would the corresponding mRNA look like?
AUUGGCGCUAAU
- remember mRNA is a COPY of the DNA strand
What do we mean by translation when we think about tRNA’s function?
tRNA helps to translate genetic information into a polypeptide chain because tRNA on one end contains nucleobases that match up to the mRNA and the other end of the tRNA contains an amino acid that will be a part of the polypeptide chain
what is the structure of tRNA?
top has amino acid, middle is a clove shaped loop, and the bottom has an anticodon (which is a set of 3 RNA nucleobases)
see picture:https://static.vecteezy.com/system/resources/previews/048/074/101/non_2x/structure-of-trna-diagram-vector.jpg
a tRNA has the anticodon of AGC – what sequence on the mRNA will it match up to?
UCG
an anticodon is always made up of how many nucleobases?
ONLY 3 NUCLEOBASES
How does the cell know when to STOP protein synthesis?
the mRNA sequence will have a STOP codon which signifies to the cell that no more amino acids needs to be added to the polypeptide chain
What are the stop codons?
UAA, UGA, UAG –> when the ribosome sees this on the mRNA it stops protein synthesis
