Test 2013 Flashcards
(137 cards)
Find the proper set of functions performed by endoplasmic reticulum:
Lipid synthesis, xenobiotics degradation, glicogen storage
The ribosome size is usually expressed in units of
Sedimentation (S)
Which description of purines and pyrimidines frequency in DNA structure is correct?
A+G=T+C
Single groove can be found in the structure of
Left-handed spiral of Z-DNA
The true statement about the histones is
They are small, positively charged proteins of five major types
DNA is a polymer composed of:
Nucleotides linked together via phospodiester bonds
The aim of the Hershey & Chase’s experiment was to show that
Only DNA is inherited, the envelopes and synthesized separately for each generation
In Avery’s experiment the cells of rough Pneumococcus strain were mixed with purified lysate of
Pneumococcus S strain cells. This experiment led to the conclusion that
Genetic information is nor carried by proteins or lipids
Valine is coded by the following triplets: GUU, GUC, GUA, and GUG. Which feature of the
genetic code is related with this coding ability?
Degeneration
Crick’s (Wobbie) hypothesis describes pairing between
The third base of the codon and the first base of the anticodon
Inosine in the anticodon can pair with
Uracil, cytosine or adenine
What kind of DNA III polymerase nucleolytic activity is used to ensure proofreading during DNA
synthesis?
3’-5’ exonuclease
Choose the correct description of the termination of replication in Prokaryotes
DnaB protein is inhibited by Tus protein
DNA replication in Eukaryotes is:
Semiconservative. Protein machinery participates in its initiation and it is present in
nucleus during whole cell cycle.
Choose the proper terms to properly fill the following sentence: “In Meselsohn-Stahl experiment
the XXX was used to demonstrate the YYY character of ZZZ.”
XXX= centrifugation, YYY0 semiconservative; ZZZ= replication
RNA polymerase moves along the template strand until it transcribes
(Not sure about the combination…)
5’ATCCGTTACGGGGCGCGGTTTTTTT3’
Which sequence has to be repeated in the operon attenuator region when this operon is involved in
synthesis of polypeptides rich in tryptophan?
UGA
The binding sites for DnaA proteins are
9-nucleotide sequence present in OriC
Due to the process of alternative splicing
The same mRNA molecule can be used in synthesis of different proteins
Which of the following processes occurs during posttranscriptional processing of the 3’ end of the
pre-mRNA?
Attachment of the poly-A tail
Which of the following nucleotide sequences in prokaryotic mRNA will allow for initialization
and further translation of the whole given sequence?
5’AUG
Product of the transcription and translation of the matrix DNA sequence 3’-TACTTTGGCACT-5’
is shown correctly by
Methionine, lysine, proline, stop
The right sequence of the association of the elements of the initiation complex during the
translation in Eukaryote is given by
40S ribosome subunit, mRNA, tRNA met , 60 S ribosome subunit
Lac operon structural genes encode:
Beta-galactosidase, permease, transacetylase