Unit 3 Exam

Question 1

Prokaryotic cells lack a nucleus. Therefore, the gene in prokaryotic cells are:

Answer 1

transcribed and translated almost simultaneously; transcriptionally controlled because translation begins before transcription ends

Question 2

What will result from the binding of a transcription factor to an enhancer region?

Answer 2

increased transcription of a distant gene

Question 3

Cancer causing genes are called

Answer 3

oncogenes

Question 4

The sugar used in RNA is

Answer 4

Ribose

Question 5

The correct pairing of bases in DNA is

Answer 5

A-T; C-G

Question 6

The RNA components of ribosomes are synthesized in the

Answer 6

nucleolus

Question 7

Protein synthesis is carried out by

Answer 7

Ribosomes

Question 8

________ is the initiating amino acid of most newly synthesized proteins.

Answer 8

Methionine

Question 9

__________ is the process by which the information in DNA is transferred to RNA.

Answer 9

Transcription

Question 10

The ends of the linear chromosomes are maintained by

Answer 10

telomerase

Question 11

Which of the following components is not involved during the formation of the replication fork?

Answer 11

ligase

Question 12

If the sequence of the 5’ -3’ strand is AATGCTAC, then the complementary sequence has the following sequence:

Answer 12

3’-TTACGATG-5’

Question 13

Meselson and Stahl’s experiments proved that DNA replicates by which mode?

Answer 13

semi-conservative

Question 14

In eukaryotes, what is the DNA wrapped around?

Answer 14

histones

Question 15

The experiments by Hershey and Chase helped confirm that DNA was the hereditary material on the basis of the finding that:

Answer 15

radioactive phosphorus was found in the cell

Question 16

If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C?

Answer 16

23 percent

Question 17

How many nucleotides are in 12 mRNA codons?

Answer 17

36

Question 18

What type of base is adenine?

Answer 18

Purine

Question 19

The DNA chromosome of bacteria consists of ________.

Answer 19

A circular double stranded DNA

Question 20

DNA is synthesized in a _________ direction.

Answer 20

5’ to 3’

Question 21

Cardiac-muscle cells that must communicate with adjacent cells using electric impulses most likely have what kind of junctions between them?

Answer 21

Gap junctions

Question 22

Assume that you transfer bacteria that were grown heavy 15N nitrogen to regular medium. What percentage of the DNA is composed of one heavy and one light chain after three generations?

Answer 22

25%

Question 23

Hershey and Chase hypothesis was that DNA replication could be_ ?

Answer 23

Semiconservative, Conservative or Dispersive

Question 24

Okazaki fragments are produced during DNA replication because __________.

Answer 24

DNA polymerase can add nucleotides only to the 3’ end of the growing strand

Question 25

During DNA replication, the _______ is synthesized continuously, while the ______ is synthesized in pieces and liked by a ligase later on.

Answer 25

Leading strand; lagging

Question 26

IN eukaryotes mRNA _______, and transcription takes place in the ________.

Answer 26

Is capped, polyadenylated, and spliced; nucleus

Question 27

Gene expression in prokaryotes and eukaryotes ________.

Answer 27

Are somewhat different: in prokaryotes transcription and translation take place simultaneously, while they are separated in eukaryotes

Question 28

In eukaryotes, _______ removes _______ and links _______. Such RNA processing is nonexistent in prokaryotes.

Answer 28

Spliceosome; introns; exons

Question 29

MicroRNA has been discovered recently; it is a _____ regulator of _______.

Answer 29

Common; RNA turnover

Question 30

Alternative splicing ______.

Answer 30

Links different exons of one pre-mRNA to produce several mature mRNA.

Question 31

How many amino acids are in the eukaryotic protein, which has a 3213 nucleotide long open reading frame, including the start and the stop codons?

Answer 31

1070

Question 32

mRNA is translated in a _____ direction, and proteins are synthesized in a ________ direction.

Answer 32

5' to 3'; amino to carboxy terminus

Question 33

Protein synthesis is terminated when _______.

Answer 33

The protein release factor binds to a stop codon at the A site of the ribosome

Question 34

The anticodon for tryptophan (Trp) is 5'-CCA-3'. Which mRNA codon would the Trp-tRNA pair with?

Answer 34

5'-UGG-3'

Question 35

Use the standard genetic code table to determine which mRNA codes for the following protein: Met-Arg-Gly-Tyr-Ala-Arg

Answer 35

AUGCGAGGCUAUGCUCGGUGA

Question 36

In E. coli, the gene lacl codes the lac operon repressor. Which of the following statements is true about an E. coli strain, which is lacl-, that is null mutant for lacl?

Answer 36

There would be no lac operon repression, thus lacA, lacZ and lacY genes would be constitutively expressed regardless of the presence of lactose.

Question 37

Repressible operons are typical in ______, e.g., the _____. And inducible operons are typical in ______, e.g., the ______.

Answer 37

Anabolic pathways; trp operon; catabolic pathways; lac operon

Question 38

When lactose is _______, the lac operon is _______, since a _______ binding to the operator within the operon.

Answer 38

Absent; inactive; repressor is

Question 39

When tryptophan is present in sufficient quantities, the trp operon is ______, since the _______ binds to the operator within the operon.

Answer 39

Turned off; tryptophan-activated repressor

Question 40

______ is determined by the _____ of activators that are available in a particular tissue to bind to genomic enhancer regions.

Answer 40

Tissue specific gene expression; combination

Question 41

______ activated the lac operon, when the _______ level is low.

Answer 41

The catabolite activator protein (CAP); glucose

Question 42

What is the one characteristic that all cancer have?

Answer 42

Loss of growth control