Lab Final Review

Question 1

Briefly explain the functions of the plasma membrane.

Answer 1

barrier, transport, structure, organization, recognition

Question 2

How does a biological membrane differ from the dialysis tubing?

Answer 2

no proteins, phospholipid bilayer, no active transport

Question 3

Explain the difference between simple diffusion and facilitated diffusion

Answer 3

facilitated diffusion requires a protein channel

Question 4

What would happen if you ran the dialysis protocol, but failed to rinse off the sac after removing it from the large test tube? (How would the results differ from what you observed?)

Answer 4

Contamination, there would be outside solutes

Question 5

Describe what you see under the high-power objective for sheep’s blood in 2M (2000mM) NaCl. Give an explanation.

Answer 5

This is a hypertonic solution, the cells would shrink

Question 6

Why do you need the mortar and pestle for the wheat germ protocol but not the cheek cell protocol?

Answer 6

break cell wall

Question 7

What is contained in the homogenate before the 1st centrifugation?

Answer 7

proteins and bits of cell wall, not needed

Question 8

What is the purpose of Sodium Dodecyl Sulfate (SDS) in the experimental protocols?

Answer 8

it is a detergent that disrupted the bond between DNA and histones

Question 9

Why do you use cold ethanol in this exercise?

Answer 9

DNA is insoluble with alcohol, this creates two distinct layers

Question 10

Provide two reasons why you might not have isolated any DNA?

Answer 10

poured out precipitate instead of supernatant
denature in water bath if in there for too long

Question 11

The restriction enzyme Alu I recognizes the sequence
5’….AGCT….3’ 3’….TCGA….5’ ↓
↑ How many times will Alu I cut the following sequence?
5’….GATACGTCTGAGCTCGTTAACACTCTGCATTGCTGACGTTAACTGAGCTCAGGGATAG….3’ 3’….CTATGCAGACTCGAGCAATTGTGAGACGTAACGACTGCAATTGACTCGAGTCCCTATC….5’

Answer 11

2X

Question 12

What is different about the DNA fragments created by digestion with Alu I as com-pared to the DNA fragments created by digestion with EcoRI?

Answer 12

EcoRi creates sticky ends
Alu creates blunt ends

Question 13

Would the EcoRI enzyme digest the DNA fragment above? Why or why not?

Answer 13

no, linear sequence not there

Question 14

For circular DNA, the enzyme will

Answer 14

cut twice to create two fragments

Question 15

Which of the DNA samples have the same number of restriction sites for the restriction endonuclease used? Write the lane numbers. (Assume all samples were circular plasmids before digestion.)

Answer 15

S2 because they have the same number of black boxes as CS

Question 16

Which sample has the smallest DNA fragment? Which sample has the largest? Do you need to run a KB ladder to know which sample has the smallest DNA fragment? Why or why not?

Answer 16

Smallest: S4, lane 6 (fragments are further down)
Largest: S2, lane 4 (Fragments highest up)
No bc the fragments automatically order by size

Question 17

Assuming a circular piece of DNA (plasmid) was used as starting material, how many restriction sites were there in the DNA sample in lane 4? Now assume the plasmid used as starting material was linearized. How many restriction sites were there in the DNA sample in lane 4?

Answer 17

Restriction sites: 3 (plasmid)
Linear: 2

Question 18

Based on your analysis of the gel, what is your conclusion about the DNA samples in the picture? Do any of the samples seem to be from the same source? If so, which ones? Describe the evidence that supports your conclusion.

Answer 18

CS and S2 same source

Question 19

Refer to Table 7-1 to answer the following question. Are there any temperature values where the absorbance values for the “E” tube are quite close to the absorbance values for the “C” tube? If so, which temperature(s)? Provide a reasonable explanation for this outcome.

Answer 19

30 and 37C are similar likely because they are similar in temperature

Question 20

Explain how the crossing-over of homologous chromosomes leads to differences in gametes.

Answer 20

the alleles swap and lead to chromosomes with different genotypes

Question 21

Is it possible that one of the 2 cells that will result from completion of meiosis I contains both D alleles (DD)? Explain why or why not.

Answer 21

Yes

Question 22

How many T alleles will a gamete contain?

Answer 22

One

Question 23

Please draw a cell (2n = 6) in metaphase of mitosis.

Answer 23

Include spindle fibers and chromosomes at plate

Question 24

cell that is (2n = 4) undergoes meiosis. Please draw one of the four cells that result from completion of the second meiotic division.

Answer 24

nuclei with two haploid chromosomes chillin

Question 25

What advantage would there be for an organism to be able to turn on/off particular genes in response to certain conditions?

Answer 25

doesnt waste resources, adapt to environment

Question 26

Which plates could contain genetically transformed bacterial cells? Explain your answer

Answer 26

the +pGLO plates will most likely have transformed
the LB can’t differentiate

Question 27

Bacteria that had not taken up the pGLO plasmid could grow on which of the plates used in this experiment?

Answer 27

-pGLO/LB would grow E Coli because LB doesn’t contain ampicillin but does contain the nutrients that would allow E Coli to grow

Question 28

Which plates should be compared to determine if any genetic transformation has occurred? Why?

Answer 28

+pGLO LB/amp/ara and -pGLO/LB/amp
The -pGLO demonstrates that E Coli being used does not survive in the presence of ampicillin

Question 29

Which plate(s) should contain the greatest number of genetically modified bacteria?

Answer 29

+pGLO/LB/amp/ara plate

Question 30

Would it ever be possible for a bacterium that did not pick up the pGLO plasmid to live on the LB plates containing ampicillin?

Answer 30

Yes bc transfering plasmids can give it resistance

Question 31

How would you expect your transformation efficiency to be affected if you did not heat shock the bacteria? Why?

Answer 31

it would be lower because the heat shock opens up the pores, no bacteria would be present without it

Question 32

How would you be able to test if the colonies you observe on the LB-only plates are ampicillin resistant?

Answer 32

add ampicillin and add a bit of bacteria

Question 33

Calculate the transformation efficiency of the following experiment using the information and the results listed below and fill in the chart on the reverse side of this page.

DNA plasmid concentration: 0.5 μg/μl
250 μl CaCl2 transformation solution
10 μl pGLO plasmid solution
250 μl LB broth
100 μl spread on agar
10 colonies of transformants

Answer 33

0.5 ug/ul (DNA plasmid concentration) x 10uL (pGLO plasmid solution) = 5ug

250+10+250=510 total

100uL (spread on agar) /510uL (total)=0.196

5ugx0.196=0.98

10/0.98=10.2

Question 34

If a particular experiment were known to have a transformation efficiency of 3 × 103 bacteria/μg of DNA, how many colonies would be expected to grow on the LB/amp/ara plate? (Assume that the concentration ofDNA and fraction ofcells spread on the LB agar are 0.196)

Answer 34

3x10^3=x/0.196

x=588