bio retake Flashcards
(15 cards)
How many spaces would there be if TATTCCGGTATTCACGGCTAATACCGGTTATTCAGCG was cut?
4
What biological sample does not contain DNA?
Fingerprints
What kind of group is not a part of a nucleotide?
Carboxyl group
If the sequence of a DNA strand is ATCGTTACGAAA, what would it’s complimentary be?
TAGCAATGCTTT
Organize chromosome, genome, nucleotide, and gene from least to most genetic form:
Genome, chromosome, gene, nucleotide
What would be the first step in a crime scene investigation?
Secure the scene
When running a gel electrophoresis, DNA will migrate towards the ___________ end because DNA has a ____________ charge
Positive; negative
What is the backbone (strand) of DNA composed of?
Phosphates and sugars
According to Chargaff’s Rule, if you have 28% thymine bases, you’d have how many (percent wise) guanine bases?
22%
DNA is cut at specific sequences by using what?
Restriction enzymes
Scientists are able to cut DNA at specific sequences into multiple segments known as what?
RFLP’s
What is not a way that blood can be analyzed (at a crime scene)?
The color of blood can indicate venous or arterial
In a gel electrophoresis, the smaller the DNA fragment…
…the farther it moves down the gel
A molecule composed of nucleotides is what?
Nucleic acids
If blood droplets fall from directly above, it will leave a __________ stain:
Circular