Chapter 7 Flashcards
What are the base pairing rules for DNA?
Cytosine with guanine and Adine with thymine
What is purine?
Nitrogen bases with two rings.
What is pyrimidine?
Nitrogen bases with one ring
In regards to nitrogen bases, explain why each ring of the DNA ladder is the same size.
The way they connect each pair as uniform in length.
Why is it important that covalent bonds hold the backbone together and hydrogen bonds hold the nitrogen bases together?
So they can hold individual strands together securely.
Who won the Nobel prize for the discovery of DNA’s structure?
Rosalind Franklin‘s research was not credited when they stole copies of her work.
Why is DNA replication “semi-conservative?”
It will replicate half the double helix and find a new mate partner.
Explain the process of DNA replication
Replication is when the double helix starts unwinding. The origin of replication does is followed to where single strand protein stabilize it. The replication fork assist the process with extreme accuracy.
Explain Helicase
It unwinds parental double helix.
Explain DNA polymerase
Synthesizes strands of DNA
Explain DNA ligase
Joins Okazaki fragment
Explain RNA polymerase
Synthesizes an RNA primer
Explain the difference between the leading strand and lagging strand and DNA replication.
Leading strand is smoother than the lagging strand
What is Okazaki fragment?
Short stretch of DNA made during replication
Why is RNA important?
Because it carries genetic information from DNA to ribosomes
Explain what happens in the process of transcription and translation
MRNA travels to the cytoplasm from the nucleus
Complete the following Venn diagram, including seven total details
Show the products of transcription and translation in the example below. Use the DNA sequence to make the complementary mRNA strand. Create the IRNA anticodon that will attach to the mRNA. Use the mRNA strand and codon chart to determine the amino acid sequence.
DNA equals
TACCGGGATAATCAAGGGCGATTCGTTAA
mRNA equals
AUGGCCCUAUUAGUUCCCGCUAAGCCAAUU
TRNA equals
UACCGGGATAATCCAAGGGCGAUUCGGUUAA
Amino acid equals
MET ALA LEU LEU VAL PRO ALA LYS PRO IIE
Why is a codon chart used in
It is a reference tool for a genetic code
what is a mutation?
Permanent changes in data sequence
The majority of mutations are
Harmful or meaningless
List three examples of mutagens
X-rays, UV light, chemicals
How can mutations occur?
Spontaneous or when DNA is exposed to mutagens.
What is a point mutation
A mutation affecting only one or very few nucleotides in a gene sequence
