DNA replication Flashcards
1
Q
What direction do the DNA strands run to one another?
A
The DNA strands run anti-parallel to one another
2
Q
In the double helix, where are the base pairs located?
A
The base pairs are stacked on the inside
3
Q
What 2 grooves are there on DNA?
A
There is a major and a minor groove in DNA
4
Q
What charge is the phosphodiester backbone in DNA?
A
The backbone has a negative charge
5
Q
Is the DNA a right or left handed double helix?
A
DNA runs in a right handed double helix
6
Q
What are the building blocks of DNA called?
A
Deoxynucleotide triphosphates
7
Q
What does DNA synthesis require and what are the different types of this?
A
It requires deoxynucleotide triphosphates
dNTP- dCTP, dGTP, dATP, dTTP
8
Q
On the following diagram label the phosphate groups either alpha, beta or gamma
A
9
Q
On DNA there is a 5’, 4’, 3’, 2’ and 1’ carbon, why are these referred to as prime carbons?
A
A prime carbon is a carbon that is located on a sugar
10
Q
What is the driving force of DNA synthesis?
A
The hydrolysis of pyrophosphate
11
Q
What functional group is located at both the 5’ and 3’ end of ssDNA?
A
An alcohol group
12
Q
When new nucleotides attach to DNA, what end do they join onto?
A
They attach onto the 3’ end of DNA
13
Q
In the Watson-Crick (W-C) model of DNA, what are the base pairs and the number of H bonds between each one?
A
The base pairs are;
AT- 2 H bonds
CG- 3 H bonds
14
Q
Whats some of the issues with DNA replication?
A
Everytime a cell divides its entire DNA content must be exactly replicated so that a comple copy is given to each daughter cell
15
Q
Whats the genome size for E. coli and humans?
A
E. Coli (4.6x106 bp)
Humans (6x109 bp)
16
Q
What type of replication is DNA replication?
A
Semi-conservative replication (as demonstrated by Meselson and Stahl)
17
Q
What happened in the experiment that Meselson and Stahl undertook in order to support their theory for semi-conservative replication?
A
- They grew bacteria on heavy, non-radioactive isotope of nitrgoen (15N)
- Cells containing the labelled DNA were then transferred to a medium containing the normal isotope of Nitrogen (14N)
- The DNA was then isolated after each generation
- The DNA was seperated by a density gradient centrifugation
- At zero: All DNA has 15N
- After 1 generation: All DNA has a density between 15N and 14N
- After 2 generations: 50% has a density of 14N and 50% is an intermediate
- After 3 generations: 75% has a density of 14N and 25% is an intermediate
18
Q
Is there an origin of replication of DNA on the E. coli chromosome?
A
Yes
19
Q
In E. Coli does DNA replicate bidirectionally or unidirectional ?
What does this mean?
A
From the origin of replication in E.Coli, the DNA replicates bidirectionally
This means it starts from its origin and replicates round the circle
20
Q
The following image shows bidirectional replication, what experiment was done to prove this was the case and why does this show bidirectional as opposed to unidirectional?
A
Firstly the genome was exposed to a pulse of low radioactivity before then being chased with high radioactivity
Bidirectional replication showed to start of strong, go weak in the middle then strong at the ends (like seen in the image with the thin and thicker bands)
Unidirectional replication tends to starts week before being strong at the end
21
Q
What 4 main issues make DNA replication a much more complex idea then whats originally thought and why are these make it difficult?
A
- The antiparallel nature of the DNA strands:
when DNA is opened up it is exposing in different directions and as DNA syntheses only works in 5’ to 3’ then the 3’ to 5’ is a problem
- The coiling of the two strands around each other: could get twisted up as moving so fast per second
- The circular nature of (bacterial) genomes: start at one end and have to go around in a circle and also possible multiple origins of replication
- Stacking of bases within the helix: everything you need is in the middle of the helix
22
Q
What was the first enzyme that was isolated and by who?
A
The first enzyme to be isolated what DNA Polymerase I by Kornberg in 1958
23
Q
Tell me about the structure of DNA polymerase I (number of chains, mw, molecules per cell)
A
Its a single polypeptide chain (mw 109,000) about 400 molecules per cell
24
Q
What does DNA polymerase I require?
A
It requires all 4 dNTPs, template strands and primers
25
Why can DNA polymerase I only add onto existing 3'-OH terminus
As its not self-priming
26
Whats the strand thats used to produce the DNA in the 5' to 3' direction?
The 3' which is the template strand
27
Polymerisation is processive what does this mean?
This means that it moves along the DNA before randomly falling off after about **10-100 nucleotides** added per binding event. This is roughly **10 nucleotides per second**
28
What does Pol I bind to ?
Nicked or gapped (not to intact ds DNA or ss DNA)
29
Whats **Nick translation**?
Its when there is a breakage in the phosphodiester backbone and then pol I can attach to the 3' end of the DNA and synthesis and produce more DNA whilst removing further DNA bases in front as it movves along the DNA chain
30
DNA polymerase I is an enzme with multiple activities, what are they?
5'-3' polymerase
3'-5' exonuclease (proof-reading)
5'-3' exonuclease (nick translation)
31
When DNA polymerase I is treated with protease, what does it produce?
Small N-terminal fragment (5'- exonuclease) and large C-terminal fragment (Klenow fragment) which contains polymerase and 3'-exonuclease
32
The crystal structure of the Klenow fragment looks as shown in the image, label each of the parts and its direction?
What is at each site?
Where does DNA sit?
**Palm** has an active site
**Fingers** is the position template
**Thumb** binds the DNA as it leaves and is important for processivity
DNA sits in the palm of the enzyme
33
What does **Klenow fragments** require and what are they held in place by?
They require 2 bound metal ions of **Mg2+** and these are held in place by aspartate residues
34
What is the role of the Klenow fragment?
It positions the 3'- end of the primer and incoming dNTP in order to enhance the catalytic reaction
35
Tell me about the Klenow fragments shape and why it is like this?
The shape is complementary to the correctly formed base pair in order to lead to specificity e.g. GC and AT pairs are the same size and shape
incorrect pairings are wrong in size and shape in order to fit into the active site of the enzyme
36
How does the Klenow fragment achieve the complimentary shape?
Its achieved by specific hydrogen bonding ('molecular ruler') and the conformational change of the polymerase upon binding to its correct substrates
37
What can't the Klenow fragments incorporate and why?
They cannot incorporate ribonucleotide triphosphates due to a steric clash with the 2'-OH on the sugar
38
How does the enzyme “decide” between polymerase and exonuclease activity?
The exonuclease pocket is seperate from the polymerase site on the enzyme
Addition of a new base is fast compared to the exonuclease activity
However, addition to a mismatched base is slow and allows time for the strand to contact the exonuclease site
39
Is Pol I the main replicative enzyme?
No, its importany but not the main
40
Tell me about the rate of polymerisation in Pol I, why is this the case?
Polymerisation is slow (it would take \>100 hours to replicate the E. Coli genome)
Its only moderatly processive (20-100 nts per binding event but needs to replicate the whole genome)
Theres too many copies per cell (\>400; which is wasted energy)
41
Whats the role for DNA pol I in vivo ?
in vivo: In vivo refers to when research or work is done with or within an entire, living organism
**PolA is the gene for the protein DNA pol I**
PolA mutants are viable and can replicate (1% normal activity) but accumulated small DNA fragments and cells were UV sensitive with a high rate of mutation
Suggests that Pol I has a role in replication (and repair) but is NOT the ‘real’ replicative enzyme (will revisit Pol I later)
PolA is a protein involved in the origin of replication
42
What is pol II and pol III only detectable in?
Whats their activity and why is this the case?
polA mutants , the combined activity of pol II and pol III is less than 5%
This is because they are usuaully masked by DNA pol I
43
What are the 5 polymerases that have now been isolated in E. coli?
Whats each of their functions?
**Pol I:** Functions in repair and replication
**Pol II:** Functions in DNA repair
**Pol III:** Principle DNA replication enzyme (the main replicative enzyme)
**Pol IV:** Functions in DNA repair
**Pol V**: Functions in DNA repair
44
How many molecules does DNA pol III have per cell?
10 molecules per cell
45
Tell me about the rate of polymerisation in pol III
High rate of polymerisation (1600 nucleotides per second)
46
Whats DNA pol III essential for?
Viability, cells can't divide without it
47
Tell me about the processivity of pol III
Its **higly processive,** it doesn't fall off once it starts replicating DNA as the strand is clamped by another protein
48
What protein is pol III clamped by?
\>50,000 nucleotides are added per binding event because it is clamped onto the DNA by the **beta subunit (dnaN)**
49
Whats pol III structure described as?
Complex multimeric enzyme
50
Tell me about pol III polypeptide components?
It has 22 polypeptide components of at least 10 types
51
DNA pol III is a **Holoenzyme,** with 2 core enzyme pol III which each consist of three subunits, what are these subunits?
α, ɛ and θ
52
What does the alpha subunit of pol III undertake?
polymerisation of 3'-OH additions
53
Whats does the e subunit of DNA pol III undertake?
3' exonuclease- proof reading
54
What does DNA pol III not contain?
a 5'-3' exonuclease
55
How can we determine which enzymes (proteins) are important?
Since any mutation will be lethal this is studied using conditionally lethal mutants - **temperature-sensitive mutants**
Powerful tools for **studying loss-of-function phenotypes**, in particular essential genes, since the mutation is only lethal (conditionally) at certain temperatures, e.g. cells survive at 20º C but not 37º C
**Mutation usually effects protein structure**
Then by seeing which proteins are effecting and what can't occur if they don't work, we can see their importance
56
Mutants are divided into two broad categories, what are these and what do these mutants do?
Give examples for each
1. **Quick stop mutants:** These immediately halt DNA replication (e.g. dnaE, dnaG, lig...)
2. **Slow stop mutants:** These allow replication to finish but stop further replication from happening after (e.g. dnaA)
57
Dont need to know but for interest, here are some enzymes involved in dna replication
58
So give some general facts as to why so many enzymes are needed for DNA replication
* DNA strands are **antiparallel**
* All DNA polymerases are 5’-3’, extending at the 3’-OH of a pre-existing strand. **Not self-priming** – need a primer
* DNA strands are **plectonemically coiled** and need to be physically separated for semi-conservative replication
* **Pol III can’t do anything if there is something ahead of it**, it has to stop, at this case then another pol like Pol I can take over
59
Since the two DNA strands are antiparallel to each other, and all polymerases work from 5’-3’, how is the lagging strand synthesized?
Overall synthesis of this strand must be in the 3'-5' direction
60
What was Okazaki's experiment?
E. Coli culture **—►** Infect cells with phage T4 **—►** Add 3H-thymdine
**—►** Take samples at intervals **—►** lyse with alkali (pH 13)- ss DNA
**—►** alkaline sucrose density gradient
61
What did Okazaki's experiment show?
* The short fragments are always present and there is more of the longer DNA fragments
* Short fragments are the precursors of the long one's and can be "chased" into long ones
* Can do a pulse-chase experiment (as shown in image)
62
This image shows what Okazaki's experiment proved, what's wrong in it?
The image shows that the leading strand is made in bits, where actually it is formed as a continuous part so this is where the image is incorrect
63
Tell me about lagging strand synthesis, the enzyme used and what the enzyme requires
The lagging strand is **synthesised in short pieces**, which are subsequently joined together by **DNA ligase.**
DNA ligase requires a **3'-OH and 5'-P** at adjacent complementary base pairs. It also need **ATP (or NAD)** and joins the nick
some organisms may use the NAD instead of ATP for this process
64
DNA replication is descirbed as being semi-discontinuous, why is this the case?
The leading strand is synthesised continuously and the lagging strand is synthesised discontinuously, and this is why it is called semi-discontinuous replication
65
Okazaki's experiment suggested that both strands are synthesised discontinually, but the quantitative interpretation of Okazaki's experiment was wrong, why?
The reason is that U is being removed from the newly synthesised DNA which results in transient breaks which results in short fragments
66
What is an Okazaki's fragment?
Okazaki fragments are pieces of DNA that are transient components of lagging strand DNA synthesis at the replication fork
They are only found in the lagging strand as this is discontinuous. The leading strand doesn't have them as its produced continuously
67
What are the steps to the synthesis of thymidylate and whats used at each stage?
1. UMP kinase (pyrH)
2. ribonucleoside diphosphate reductase (nrdAB)
3. nucleoside diphosphate kinase (ndk)
4. dUTPase (dut)
5. thymidylate synthase (thyA)
6. dTMP kinase (tmk)
7. DNA pol III (dnaE)
68
What are the 2 ways that uracil (U) appear in DNA?
are they offensive?
1. **U is incorporated in place of T** roughly once in every 1200 bases opposite A
Pol III uses UTP in place of TTP
This incorporation is **non-offensive** as U has the same base pairing properties as T
2. U can arise **in situ** from the spontaneous deamination of C
This **is offensive** because it generates a GU base pair in place of GC, which will cause mutation to AT at the next round of replication.
G**C** --\> G**U** --\> A**U**
69
How is uracil removed from DNA?
In the majority of species, uracil residues are removed from DNA by **Uracil-N-glycosylase (ung)**
However, in certain archaeal organisms uracil can be eliminated by **AP(apyrimidinic) endonuclease (xthA)**
70
When uracil is removed from DNA, how is the gap in the chain filled?
The gap is then filled in by DNA pol I (nick translation) and sealed by DNA ligase
71
Whats the main purpose of uracil-N-glycosylase ?
To remove U opposite G, but it doesnt discriminate U opposite A
72
During replication temporary nicks are created on the leading strand, what are these known as?
What two mutations can cause this?
pseudo-Okazaki fragments
ung and dut mutants can cause this
73
When is true semi-discontinuous replication evident?
**If the removal of U is prevented**
ung- mutant (no uracil-N-glycolsylase)
74
Whats dut-mutant?
dut- mutant – **defective dUTPase**, causes increased levels of dUTP --\> more incorporation into DNA --\> v. short fragments as more Us are removed at the replication fork
75
What are the two methods for proof reading ?
* Strand extension at the 3’-end only proceeds if the correct base has been added. If not then the 3’-exonuclease activity of pol III (dnaQ) removes it.
* dnaQ- mutants accumulate errors
76
What do all known DNA polymerases require?
a primer and extended onto the 3'-OH
77
What are primers synthesises by?
An enzyme called **primase** (dnaG)
78
What type of polymerase is primase?
An **RNA polymerase** (but not the one involved in transcription) its a specialist RNA that makes primers involved in DNA replication and as the primers are RNA its called RNA polymerase
79
Tell me some features/ characteristics of primase?
* self-priming (adding nucleotides in the 5'-3' direction)
* no editing functions (proof reading)
* primers are 5-10 nucleotides in length
80
When is primases activity increased?
In the presence of helicase (this enzyme opens up the replication fork)
81
How is the theory of primase tested?
82
What happens with the RNA primers are removed and the gaps need to be sealed?
* **Pol I** takes over on the lagging strand when the newly synthesised strand meets the previous RNA primer and removes the RNA primer by **nick translation**- using its **5'-3' exonuclease activity**
* The gap is then sealed by **DNA ligase**
* This seals the "nick" in the phosphodiester backbond, between 3'-OH and a 5'-P
* NO bases are added
83
Pol I is processive but not very, what does this mean?
It doesn't know when to stop but will just fall off at some point, sometimes it goes past the RNA prikmer but this doesnt matter
84
Even though DNA replication on the leading strand is continuous, where are primers required?
Where are primers required on the lagging strand as well?
Leading: Primers at the beginning
Lagging: Primers at beginning and for each Okazaki fragment
85
For continual opening, the DNA strand must be unwound, what is this done by?
Enzymes called **Helicases**
86
The main helicase enzyme is a product of what?
The **dnaB gene**
87
Tell me about the DNA helicase used in unwinding DNA ?
* DNA dependent ATPase (needs roughly 1 ATP per 3 bp unwound)
* Acts recessively, moving along DNA from 5' to 3' (on the lagging strand)- a molecular motor
88
Whats a syndrome that can be caused by a defective helicase?
Bloom's syndrome
and
Werner's syndrome
89
During the unwinding of DNA, the unwound single strand regions are stabilised by what?
**protein ssb** (single strand binding protein)
90
The main ssb protein is a product of what?
The main ssb is a product of the **DnaT gene**
91
How does the ssb bind to the single stranded regions?
It binds coopertively and mainly on the lagging strand
92
Why does the conformation of the helicase change?
It cycles between empty, ATP and ADP + Pi
93
Whats meant by cooperativity?
Where the binding of one protein enhances the binding of an adjacent protein
94
Tell me about cooperativity when one protein is present, then two and three?
* One alone gives relatively weak binding
* Two adjacent ones bind better
* When there is three then the one in the middle is bound more tightly then the other two
So, the proteins at the ends are bound less well and are easier to displace
95
Tell me what direction pol III polymerises and proof-reads in?
Polymerises in the 5'-3' direction
Proof-reads in the 3'-5' direction
96
What makes RNA primer?
Primase
97
Even though the lagging strand is synthesises discontinuously, is it made by the same pol III complex as the leading strand?
yes
98
During replication does the dimer dissociate from the DNA template? If it doesn't then what does it do?
The lagging strand is "looped out" before synthesis in the 5' to 3' directions
99
What stabilises this loop formation during replication?
The ssb protein
100
What do the loops expose during replication?
The loops expose the whole length of DNA to replicate from the replication fork backwards
101
What are all the subunits in the complete pol III holoenzyme?
(αεθ)2τ2(γ2δδ’ψχ)β2
102
What is the role of (αεθ) in the pol III complex?
Its the polymerase itself
103
Whats τ2 responsible in the pol III complex?
Its responsible for dimerisation- holding the two halves together
104
Whats the β-clamp responsible for in the pol III complex?
It forms a ring around the DNA to which the polymerase is attached. it ensures processivity
105
Whats γ2δδ’ψχ responsible for in the pol III complex?
This is the "clamp loader"- uses ATP to load the β-clamp onto the DNA
106
Label the subunits in the pol III holoenzyme
107
How big are the Okazaki fragments?
They are short DNA fragments which are 100-2000 nucleotides in length
108
How is the RNA primer removed in replication?
The RNA primer is removed from primer-template junction by Pol I using its nick translation activity (5'-exonuclease)
109
Nicks in the DNA backbone are sealed by what?
DNA ligase
110
Why does uracil appear in DNA?
Due to either misincorporation of dUTP or the deamination of cytosine
111
How does repllication of the lagging strand occur?
By a coordinated looping mechanism
112
What do ß-clamps clamp to and what do they prevent?
They clamp to the complex to DNA to prevent dissociation (from 20-100 to 50,000 nucleotides per binding event)
113
How are ß-clamps loaded onto the DNA?
They are loaded onto the DNA by a 'clamp loader' composed of γ2δδ’ψχ subunits- coupled to ATP binding and hydrolysis which catalyses ring opening and loading
114
What is the ß-clamp responsible for?
processivity
115
How does the ß-clamp slide along the DNA chain?
The clamo uses water as a lubricant when sliding along DNA
116
Label this cryo-EM structure
117
During replication, when must the DNA unwind?
The DNA duplex must unwind by one turn for every roughly 10 bp that are replicated
118
At what rate does pol III work at?
Pol III work at 1,600 nucleotides/second
i.e. the helix must rotate at about 1000 r.p.m
119
What is the main function of topoisomerases?
Topoisomerases are enzymes that relieve the super helical stress that is produced in front of and behind the replication fork
120
Whats another role for the topoisomerases?
Seperating the two daughter DNA molecules after the cycle of replication is complete
121
Whats the formula for supercoiling and what does each component stand for?
**Lk= N/h**
LK= the number of times that one strand passes around the other
N= the number of base pairs
h= helical repeat= 10.5
122
When looking at plasmids like pBR322 with 4361 bp, what is the value of Lk?
Lk= 4361/10.5= 415
123
What must Lk always be?
an integer
124
If the value of Lk was 440,000 for E.Coli, how many bp does it have?
440,000= bp / 10.5
bp= 4.6x106
125
How is the L value effected by circular genomes?
For a circular genome L cannot be changed, so long as the circle remains closed
126
What happens to circular DNA during supercoiling before the circle is closed?
Circular DNA is usually overwound or underwound before closing the circle, increasing or decreasing the value of Lk
127
How does the number of bp vary per turn in linear DNA, underwound circular DNA and overwound circular DNA?
In **linear DNA** there are 10.5 bp per turn
In **underwound circular DNA** this figure is greater (thought: if completely unwound it would have an infinite helical repeat)
In **overwound circular DNA** there will be a smaller helical repeat (fewer base pairs for each turn of the helix)
128
σ = ΔLk/N (typically -0.06)
What is this accomodated by?
What can it result in?
This could be accomodated by changing the value of h, the helical repeat
But it can also result in coiling the DNA molecule
129
Supercoiling can also be described by another equation, what is this?
What does each component in the equation represent?
**Lk= T + W**
Lk= linking nunber
T= **twist**- the coiling of the strands around the helical axis
W= **writhe**- the coiling of the helical axis in space
130
What is meant by the twist and the writhe in DNA?
The **twist** is the number of helical turns in the DNA and the **writhe** is the number of times the double helix crosses over on itself
131
What leads to positive and negative supercoiling?
Extra helical twists: lead to positive supercoiling
Subtractive twisting: lead to negative supercoiling
132
Do topoisomerases introduce and remove supercoils?
yes
133
Who discovered topoisomerases?
Wang and Gellert
134
What are the types of topoisomerases?
**Type I and Type II**
However type III is part of the type I
and type IV is part of the type II
135
What the role of the **type I (III) topoisomerases ?**
They catalyse the relaxation of supercoiled DNA, a thermodynamically favoured process
136
Whats the role of the **type II (IV) topoisomerases?**
Utilises free energy from ATP hydrolysis to add negative supercoils to DNA
137
In both cases, these enzymes (topoisomerases) alter the linking number by catalysing a three step process. What is this process?
1. The cleavage of one or both strands of DNA
2. the passage of a segment of DNA through this break
3. the resealing of the DNA break
138
How do topoisomerases work?
by nicking the DNA backbone, forming an enzyme-DNA complex, linked between the nicked phosphate and tyrosine in the active site of the protein.
The complex then 'swivels', rotating one strand around the other and the nick is then resealed
139
What does the topoisomerase II (IV) do and how does this effect the value of L?
They cut both strands of a duplex and passess one strand through the other
This process decreases L (the linking number) by 2
140
What type of enzyme is **DNA gyrase?**
A prokaryotic enzyme
141
Whats the role of DNA gyrase?
It introduces negative supercoils (unwinds DNA then reseals it back up again)
142
What does DNA gyrase require?
ATP
143
How does DNA gyrase effect the value of L?
It decreases L by 2 at a time; A2B2 structure
144
Tell me about the A and B structures of the DNA gyrase?
**A –** gyr (nalA) nicking closing activity inhibited by nalidixic acid and other fluoroquinolones (Ciprofloxacin ‘Cipro’)
**B-** gyrB (cou) DNA dependent ATPase inhibited by coumermycin
145
Whats the role of tyrosine in topoisomerase?
The catalytic tyrosine cleaves the DNA backbone, creating transient 5' phosphotyrosin intermediate
The break is then separated, using domain II as a hinge, a second duplex or strand of DNA is passed through
146
What is a quick and slow stop mutant?
A **quick-stop mutan**t is a type of DNA replication **temperature-sensitive** mutant (dna )in E. coli that **immediately stops DNA replication** when the temperature is increased to 42°C.
A **slow-stop mutant** is a type of DNA replication **temperature-sensitive** mutant in E.coli that can f**inish a round of replication** at the unpermissive temperature, but cannot start another.
147
What action makes DNA more negative?
uncoiling
148
How does the initiation of replication take place?
Takes place at a fixed sequence- OriC- from which the replication forks move bidirectionally until they reach the terminal sequence terC
149
What is **OriC**?
a 245 bp sequence containing 4x9 bp pair repeats and 3 x 13 bp repeats (both are AT rich)
150
What is DnaA specific to?
initiation of replication, the other steps are similar to the elongation process
151
What does DnaA bind to and interact with?
DnaA binds cooperatively to the 9 bp repeats (20-40 monomers), requires ATP
DnaA interacts with the 13 bp repeats, melting the strands
152
What does DnaB move along and what does this cause?
DnaB moves along the lagging strand in the 5'-3' direction opening up the forl, the ssDNA are stabilised by ssb
153
What is DnaG associated with?
DnaG is associated with DnaB and an RNA primer is made at each fork. primers are extended by pol III etc.
154
DnaA is an AAA+ protein, what is this?
ATPases associated with diverse cellular activities
155
What does OriC contain and what is the role of this?
What does it lead to?
OriC contains a large number of GATC sequences- substrates for dam (DNA adenosine methylase)
These methylates N6 of adenine. immediately after replicated these will be hemi-methylates. Hemi-methylation inhibits initiation
156
Tell me aboutt he replication in:
Hemi-methylated plasmids
Methylated plasmids
Unmethylated plasmids
Hemi-methylated plasmids are not replicated
Methylated undergo one round of replication
Unmethylated are replicated normally
157
At whar rate are the GATC sites methylated by dam?
Very slowly, at a rate of roughly 13 mins
a similar situation occurs at the GATC sites in the DnaA promotor- hem methylation represses expression of DnaA
158
Where do the in dam strain events occur?
At the membrane and the DNA is spooled through the membrane-bound replication apparatus
159
What does the ter region contain?
six homologous 23 bp sequences
(AATTAGTATGTTGTAACTAAAGT) – with three sites oriented in each direction. These bind the protein Tus.
160
What does the binding of Tus prevent?
The fork movement in one direction only
161
Hemi-methylated DNA at OriC has a strong affinity for what?
The cell lipid membrane-possibly assisting segregation of the two daughter chromosomes
162
What are the two circular daughter chromosomes separated by?
Topoisomerase IV
163
DNA unwinding by helicase leads to what?
positive supercoiling in front of and behind the replication fork
164
What is superhelical stress relieved by?
Topoisomerases which alter the linking number of DNA and also separate the two daughter strands after replication has occured
165
Tell about the initiation of replication?
Initiation of replication takes place at a fixed sequence called oriC
DnaA coperatively binds to OriC and melts the DNA allowing DnaB (helicase) and DnaG (primase) to initiate replication
166
The onset of replication initiation is determined by?
The cellular concentration of DnaA/ methylation of OriC
167
How does termination of replication occur?
Termination of replication take place at a fixed DNA sequence called ter
168
All the contents covered is focussing on prokaryotes but also similar stuff occurs in eukaryotes. just in eukaryotes its more complicated and its slower as the genome is larger.but they have more or less the same mechanism
169
Whats DNA melting?
Heat DNA, the 2 strands come apart (called melting), produces a sigmoidal melting curve
170
Tell me some differences of DNA replication in eukaryotes compared to prokaryotes?
* occurs in the nucleus not the cytoplasm
* Theres more genetic material to replicate (can be four orders of magnitude greater)
* DNA is more than one chromosomes (46 in humans)
* Not circular genomes
* Additional packaging (histones, nucleosomes etc.)
171
In eukaryotic replication, What is the origin of replication?
It doesn't replicate from a single origin, but from 1000s of replication forks- from ***ars (autonomously replicating sequence)***
172
Tell me about the rate of polymerase in eukaryotes as opposed to prokaryotes?
The polymerases are slower (50 nucleotides per second) and there are more DNA
173
Are Okazaki fragments present in eukaryotes?
If they are then tell me about them?
The Okazai fragments are much shorter- about 135 bp- which is about the size of a nucleosome
174
What are the 5 main eukaryotic DNA polymerases?
**(α, β, γ, δ, ε)**- in eukaryotes they take Greek letters as opposed to roman numerals
175
How many bases are the RNA primers in eukaryotic replication?
The RNA primers are only about 10 bases
176
What is the 'sliding clamp' known as in eukaryotic replication?
The 'sliding clamp' is known as the **"proliferating cell nuclear antigen" (PCNA)**
177
Tell me about **polymerase alpha** in eukaryotic replication?
Has its own **primase** activity
Not very processive
Does not associate with PCNA
Does not have 3'-5' exonuclease
Not associated with beta clamp
178
Tell me about **polymerase delta** in eukaryotic replication?
Associates with **PCNA**
processive synthesis
179
Tell me about **polymerase epsilon** in eukaryotic replication?
Analogous to Pol I
## Footnote
**Removes primers**
180
Tell me about **polymerase beta** in eukaryotic replication?
Involved in DNA repair
181
Tell me about **polymerase gamma** in eukaryotic replication?
DNA polymerase gamma (Pol γ) is the only replicative DNA polymerase found in the mitochondria
essential for copying and repair of mitochondrial DNA.
182
In eukaryotic replication how does the enzymes synthesising the leading and lagging strands interact?
They do not associate as a dimer
183
The eukaryotic polymerases do not have a 5'-3'- exonuclease activity for removing the RNA primers. Instead how is this done?
This is done by a separate **FEN1** (flap) **exonuclease**
184
How does the **FEN1 exonuclease** work?
FEN1 takes junction and cuts it very precisely at the flap overhand
It leaves no spaces
Leaves no nucleotides missing
Instead leaves a nick in the chain which is sealed by DNA ligase
185
With their multiple origins, how does the eukaryotic cell know which origins have been replicated and which still need to be replicated?
when a cell in the G2 phase of the cell cycle is fused with a cell in S phase, the DNA of the G2 nucleus does not begin replicating again, even though replication is proceeding normally in the S-phase nucleus. Not until mitosis is completed, can freshly synthesized DNA be replicated again.
186
What are the stages of the cell cycle and what occurs in each one?
G1: Growth and preparation of the chromosomes for replication
S= synthesis of DNA (and centrosomes)
G2= preparation for M
M= mitosis
187
In order to be replicated, each origin of replication in eukaryotic replication must be bound by what?
An **Origin replication complex (ORC).** These remain on the DNA throughout the process
188
What accumulates in the G1 in eukaryotic replication?
Accessory proteins called **licensing factors** which accumulate in the nucleus during G1
189
What binds to the ORC in eukaryotic replication and what are these essential for?
**Cdc-1 and Cdt-1** bind to the ORC and are essential for coating the DNA with **MCM proteins**
190
in eukaryotic replication what DNA can only be replicated?
Those coated with MCM proteins (there are 6 of them)
191
What happens in eukaryotic replication once replication being in the S-phase?
Cdc-6 and Cdc-1 leave the ORCs (the latter by ubiquitination and destruction in proteasomes0
192
in eukaryotic replication when do the MCM proteins often leave?
In front of the advancing replication fork
193
What is the end of replication problem that arises in eukaryotic replication?
194
In the end of replication problem, what is the **Hayflick limit** in eukaryotes?
There are 40 divisions followed by senescence
195
Why is the end of replication problem not an issue in organisms with a circular genome?
196
What can some organisms do to overcome the end of replication problem?
197
What are **Telomeres?**
Caps at the end of each strand of DNA that protect our chromosomes
(like the plastic ends of shoelaces)
198
Whats Telomerase?
Also called terminal transferase, its a ribonucleoprotein that adds a species dependent telomere repeat sequence to the 3' end of telomeres
199
In eukaryotic cells, the end of replication problem is solved how?
By adding repeated units of simple sequences to the chromosomal ends (telomeres)
These are not synthesises by semi-conservative replication, but are added directly by the enzyme **telomerase**
200
In humans and all higher eukaryotes, what is the repeat sequence that is often added by telomerase?
**TTAGGG**
The last 50-100 bases at the 3'-end of each chromosome are single stranded
201
in eukaryotic replication what is telomere length regulated by?
Telomere binding proteins (TBP) such as TRF1 and TRF2
202
What is Telomerase inactivated in?
Telomerase is inactive in most differentiated cells
There is a correlation between ageing, senescence and low levels of telomerase
Hence why cell division tends to stop after 40 cycles
203
How does telomerase activity affected by being in cancer cells?
They can be re-activated in cancer/ tumour cells which is why there is a constant replication occuring
204
205
Define **senescence?**
The condition or process of deterioration with age
206
What are most differentiated cells limited by?
The Hayflick limit
207
Many animals and plant viruses have genomes composed of what?
RNA (ignores the central dogma)
208
What are viral genomes copied by?
By an RNA-dependent RNA polymerase called **RNA replicase** encoded by the viral genome
209
The RNA virus can be in two different forms what are these?
They can be positively stranded or negatively stranded
plus is the mRNA
minus is the complementary to this
210
The plus stranded viral RNA is copied directly to make the minus strand, what is this then used to do?
Used as a template for making more plus strand
211
Do viral RNA's require a primer?
They can be self-priming so no primer is required
212
Why do viruses often have so many errors ?
They do not have proof reading activity and therefore are highly error prone
213
Name some viruses that replicate via RNA replication?
Ebola, Influenza, coronavirus
214
What is a **Retrovirus** and give an example of one?
A Retrovirus such as HIV have a single stranded RNA genome
215
How do viruses like HIV replicate?
* The ssRNA is copied into dsDNA by a virally encoded **Reverse transcriptase** before it is integrated into the host genome
* It is first synthesises a copy of the DNA strand, forming a **RNA/DNA hybrid**
* To do this it uses **tRNA**lys as a primer
* The RNA strand is then degraded by the RNase hydrid (RNA/DNA hybrid) activity of the enzyme before it synthesises the second strand
216
What is reverse transcriptase commonly used as a tool in?
molecular biology for copying mRNA into cDNA
