Exam 3 Questions

Question 1

1. Which of the lists below might contain sufficient ingredients to allow DNA replication to occur in a test tube?

A) deoxynucleotide, template DNA, DNA polymerase
B) deoxynucleotides, primers, template DNA, DNA polymerase
C) primers, template DNA, DNA polymerase
D) template DNA, DNA polymerase

Answer 1

B) deoxynucleotides, primers, template DNA, DNA polymerase

Question 2

2. DNA polymerase III adds nucleotides ________.
   A) to the 5’ end of the RNA primer
   B) in the place of the primer RNA after it is removed
   C) to the 3’ end of the RNA primer
   D) to internal sites in the DNA template
   E) to both ends of the RNA primer

Answer 2

C) to the 3’ end of the RNA primer

Question 3

3. In which of the following circumstances would the trp operon be expressed?
   A) When there is a high level of tryptophan in the cell
   B) When there is a low level of tryptophan in the cell
   C) When the trp repressor is bound to tryptophan
   D) When the trp repressor is bound to the regulatory sequence
   E) It is never expressed

Answer 3

B) When there is a low level of tryptophan in the cell`

Question 4

4. Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes?
   A) Initiation at origin of replication, bidirectional, conservative
   B) Initiation at origin of replication, unidirectional, semiconservative
   C) Initiation at origin of replication, bidirectional, semiconservative
   D) Initiation at promoter, bidirectional, conservative
   E) Initiation at promoter, bidirectional, dispersive
   F) None of these are correct

Answer 4

C) Initiation at origin of replication, bidirectional, semiconservative

Question 5

5. The Meselson and Stahl experiment refers to an experiment that led to a better understanding of
   A) DNA structure
   B) Translation
   C) Telomere elongation
   D) DNA replication
   E) Transcription

Answer 5

D) DNA replication

Question 6

6. Transcription starts at a specific region of DNA called a(n)
   A) Shine Dalgarno site
   B) origin
   C) promoter
   D) translational start site
   E) Rho site

Answer 6

C) promoter

Question 7

7. The name of the factor that “chases” the RNA polymerase and terminates transcription in prokaryotes is:
   A) Termination factor
   B) Sigma
   C) Gamma
   D) Rho
   E) None of the above

Answer 7

D) Rho

Question 8

Use the DNA replication figure to the right to answer questions 8-11
8. “B” represents a factor that “melts” the double stranded, and forms two single stranded pieces of DNA. This factor
is called a:
A) ligase
B) helicase
C) DNA polymerase III
D) DNA gyrase
E) primase
F) single stranded binding protein

Answer 8

B) helicase

Question 9

9. “F” represents a factor that is producing a small molecule of RNA. The factor is
   called a:
   A) ligase
   B) helicase
   C) DNA polymerase III
   D) primase
   E) single stranded binding protein

Answer 9

D) primase

Question 10

10. “A” represents a factor that unwinds positive supercoils upstream of the replication fork. The factor is called a:
    A) ligase
    B) helicase
    C) DNA polymerase III
    D) DNA gyrase
    E) primase
    F) single stranded binding protein

Answer 10

D) DNA gyrase

Question 11

11. The DNA strand indicated with number 2 most likely represents:
    A) the leading strand
    B) the lagging strand
    C) the parental strand
    D) bidirectional replication
    E) none of the above

Answer 11

A) the leading strand

Question 12

12. The polarity of RNA synthesis is
    A) 5’→3’.
    B) 3’→5’.
    C) 5’→2’.
    D) 2’→5’.
    E) None of the choices is correct.

Answer 12

A) 5’→3’.

Question 13

13. Which of the following RNA molecules is required for the process of translation?
    A) crRNA
    B) tRNA
    C) siRNA
    D) miRNA
    E) lncRNA

Answer 13

B) tRNA

Question 14

14. Eukaryotes modify a primary RNA transcript to generate a final mRNA product. These modifications include
    A) removing exons from the transcript
    B) removing uracil from the transcript
    C) removing introns from the transcript
    D) adding introns to the transcript
    E) none of the above

Answer 14

C) removing introns from the transcript

Question 15

15. Including start and stop codons, how many nucleotides would it take to specify the following sequence of amino
    acids: fmet-ser-asn-asp-asp-ser-asn-trp
    A) 8
    B) 9
    C) 16
    D) 24
    E) 27

Answer 15

E) 27

Question 16

16. Which of the following processes would be most directly affected or impaired by sequence mutations within a Shine-
    Dalgarno sequence?
    A) replication
    B) transcription
    C) translation
    D) nucleotide excision repair

Answer 16

C) translation

Question 17

17. If a deletion occurs in a gene that encodes DNA polymerase I and no functional DNA polymerase I is produced, what
    will be the MOST likely consequence of this mutation?
    A) The DNA would contain pieces of RNA.
    B) The DNA would not exist in a supercoiled state.
    C) There would be no DNA replication on the leading or lagging strands.
    D) There would be no RNA primers laid down
    E) The DNA will not be able to unwind to initiate replication

Answer 17

A) The DNA would contain pieces of RNA.

Question 18

20. An amino acid is composed of all the following components except which of the following?
    A) Amino group
    B) Carboxylic acid
    C) Phosphate group
    D) Side group (R)
    E) Alpha carbon atom

Answer 18

C) Phosphate group

Question 18

18. Which of the following schemes best describes the Central Dogma of Molecular Biology
    A) DNA to protein to RNA
    B) RNA to DNA to protein
    C) Protein to RNA to DNA
    D) DNA to RNA to protein
    E) Protein to DNA to RNA

Answer 18

D) DNA to RNA to protein

Question 19

21. Which of these is NOT a characteristic of the genetic code?
    A) The code is degenerate.
    B) The code is used by nearly every living organism.
    C) The code is nonoverlapping
    D) There are the exact same number of codons as there are amino acids.
    E) The code is unambiguous

Answer 19

D) There are the exact same number of codons as there are amino acids

Question 19

19. What is the name of the enzyme that prevents chromosome shortening following DNA replication in eukaryotes?
    A) RNA Polymerase
    B) Primase
    C) Telomerase
    D) Gyrase
    E) Single stranded binding proteins

Answer 19

C) Telomerase

Question 20

22. Multiple folded polypeptides come together to give a functional protein. This level of protein structure is called the
    A) Primary structure
    B) Secondary structure
    C) Tertiary structure
    D) Quaternary structure
    E) Quinary structure

Answer 20

D) Quaternary structure

Question 21

27. In prokaryotes, transcription occurs in the _______ and translation occurs in the _______.
    A) Cytoplasm; nucleus
    B) Nucleus; cytoplasm
    C) Cytoplasm; cytoplasm
    D) Nucleus; nucleus

Answer 21

C) Cytoplasm; cytoplasm

Question 21

23. If the structure depicted in the figure is found in a prokaryotic cell. What is structure A?
    A) Small subunit (30S) of the 70S ribosome
    B) Sigma factor of RNA polymerase
    C) Alpha subunit of RNA polymerase
    D) DNA polymerase small subunit
    E) None of the above

Answer 21

A) Small subunit (30S) of the 70S ribosome

Question 22

24. The site indicated by C is referred to as the A) Exit tRNA binding site (E site) B) Ribosome binding site (R site) C) Beta RNA binding site (B site) D) Aminoacyl binding site (A site) E) Peptidyl binding site (P site)

Answer 22

E) Peptidyl binding site (P site)

Question 23

25. CRISPR-Cas is used by scientists as a molecular tool to modify DNA and change its expression. That is not its natural function. What is the natural function of CRISPR-Cas9? A) Bacterial immune defense against bacteriophages B) Integral part of the ribosome C) Provides the information to make a protein D) Carries amino acids for translation E) The function is unknown

Answer 23

A) Bacterial immune defense against bacteriophages

Question 24

26. A tRNA anticodon may recognize more than one codon at its 5’ position. This is referred to as the _______position. A) Exit B) Entry C) Wobble D) Wild E) Complementary

Answer 24

C) Wobble

Question 25

28. Which of the following is NOT a basic concept of gene regulation? A) All proteins are encoded by genes B) All gene expression is regulated by siRNAs C) Gene expression makes biochemical sense D) Not all genes are expressed all of the time

Answer 25

B) All gene expression is regulated by siRNAs

Question 26

29. Which of the following is NOT a method of control of gene expression in Eukaryotes? A) RNA splicing B) RNA stability C) RNAi D) Transcription E) All of the above are levels of control of gene expression in eukaryotes

Answer 26

E) All of the above are levels of control of gene expression in eukaryotes

Question 27

30. What is the consequence of methylation of DNA sequences? A) Active transcription B) Transcriptional repression C) Recruitment of RNA polymerase D) Translational stalling E) Insulator sequence formation

Answer 27

B) Transcriptional repression

Question 28

31. Genes that are always being expressed are called A) Constitutively expressed genes B) Inducible genes C) Repressible genes D) Structural genes E) Operon genes

Answer 28

A) Constitutively expressed genes

Question 28

32. Where would the lac repressor be bound in a (wild type) E. coli cell that is growing in low glucose and high lactose? (I = lac repressor gene; Z, Y, A = lac operon structural genes; P = lac promoter; O = lac operator) A) P B) O C) P and O D) I, P, O E) The repressor would not be bound

Answer 28

E) The repressor would not be bound

Question 29

33. Changes in the chromatin structure that lead to altered gene expression are called ______________ changes. A) Induced B) Epigenetic C) RNA stability D) Translational E) Repressible

Answer 29

B) Epigenetic

Question 30

34. (8 pts) Label the following as: occurs in Prokaryotes (P), Eukaryotes (E), Neither (N), or Both (B). a. Synthesis of DNA in a 3’ to 5’ direction b. Presence of Okazaki fragments during DNA replication c. Transcription AND translation can happen in the cytoplasm at the same time d. Multiple origins on linear DNA molecules e. Sigma subunit f. Polycistronic RNA is common g. RNA synthesis using nucleotides with a 2’ hydroxyl group on the sugar h. Chromatin structure and the binding of histone proteins is important in gene expression

Answer 30

4. (8 pts) Label the following as: occurs in Prokaryotes (P), Eukaryotes (E), Neither (N), or Both (B). a. Synthesis of DNA in a 3’ to 5’ direction N b. Presence of Okazaki fragments during DNA replication B c. Transcription AND translation can happen in the cytoplasm at the same time P d. Multiple origins on linear DNA molecules E e. Sigma subunit P f. Polycistronic RNA is common P g. RNA synthesis using nucleotides with a 2’ hydroxyl group on the sugar B h. Chromatin structure and the binding of histone proteins is important in gene expression E

Question 30

35. (6 pts) Fill in the blanks in the “level of transcription” column of this table with (+) for high levels of transcription, (+/–) for moderate levels of transcription, and (–) for minimal/no transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type with no partial diploidy

Answer 30

Question 31

36. (2 pts) What effect would a mutant lac repressor that cannot bind to the lac operator have on the function of the lac operon (assuming no glucose or lactose is present) with regard to the amount of beta-galactosidase transcribed? (Use +, +/-, or –, as in 35)

Answer 31

+

Question 32

37. (5 pts) Order the events related to prokaryotic translation. a. The ribosome translocates. The first tRNA exits the ribosome, the 2nd tRNA translocates to the P site, and the A site is empty. b. The elongation process continues with another amino-acyl tRNA entering the A site, another peptide bond forms, the ribosome translocates, and an empty tRNA that was in the P site now exits through the E site. c. The second tRNA enters the A site of the ribosome with an anticodon that is complementary to the second codon. d. The large ribosomal subunit docks with the small subunit. e. A stop codon is positioned in the A site. f. A release factor binds to the A site, releases the polypeptide from the last tRNA, and subsequently disassembles the large and small units of the ribosome. g. The small ribosomal subunit binds to the start codon, Shine-Dalgarno sequence, initiation factors, and a tRNA loaded with f-Met. h. A dipeptide forms between the first two amino acids

Answer 32

a. 5 The ribosome translocates. The first tRNA exits the ribosome, the 2nd tRNA translocates to the P site, and the A site is empty. b. 6 The elongation process continues with another amino-acyl tRNA entering the A site, another peptide bond forms, the ribosome translocates, and an empty tRNA that was in the P site now exits through the E site. c. 3 The second tRNA enters the A site of the ribosome with an anticodon that is complementary to the second codon. d. 2 The large ribosomal subunit docks with the small subunit. e. 7 A stop codon is positioned in the A site. f. 8 A release factor binds to the A site, releases the polypeptide from the last tRNA, and subsequently disassembles the large and small units of the ribosome. g. 1 The small ribosomal subunit binds to the start codon, Shine-Dalgarno sequence, initiation factors, and a tRNA loaded with f-Met. h. 4 A dipeptide forms between the first two amino acids

Question 33

38. (10 pts) For a eukaryotic gene with a promoter sequence in the template strand with the sequence 3’-TAATAATA-5’, the transcript begins with the first nucleotide following the promoter sequence and transcription terminates immediately after the sequence 3’-CCCCC-5’ in the template strand. The sequence also has a short intron that would be removed to produce the mature mRNA. The non-template strand is provided below. What is the mRNA sequence that would be transcribed from the template strand after the intron is removed (be sure to indicate the 5’ and 3’ end) and indicate any modifications to make this a mature eukaryotic mRNA. (You may just write what the modifications are and where they would be found-not draw them, but the intron must be removed from the transcript. 5’CCCCCGATTATTATTCATGACTAGGGGCGTGGATGAAGCGCAACCCGAAATAAGTAATAATGGGGGCCC3'

Answer 33

5’CCCCCGATTATTAT 5’mGCAUGACUAGGGGCCGCAACCCGAAAUAAGUAAUAAUGGGGG PolyA3’ CCC3’ 5’Mgc AUG ACU AGG GGC CGC AAC CCG AAA UAAGUAAUAAUPolyA3’

Question 34

39. (3 pts) What would be the amino acid sequence in the polypeptide produced from the mRNA in question 38?

Answer 34

Met Thr Arg Gly Arg Asn Pro Lys