Genetics Test 2 Ch. 9 Flashcards
(30 cards)
1) What features of proteins does two- dimensional gel electrophoresis exploit in order to separate proteins?<br></br>A) charge and pH<br></br>B) shape and size<br></br>C) pH and polarity<br></br>D) charge and shape<br></br>E) size and charge
Answer: E
2) The Shine- Dalgarno sequence in bacteria ________.<br></br>A) is a region of the tRNA molecule involved in formation of charged tRNAs <br></br>B) is a purine- rich consensus sequence found in the 5ȝ UTR of the mRNA<br></br>C) is a consensus sequence involved in the termination of translation<br></br>D) is a pyrimidine- rich consensus sequence found in the 3ȝ UTR of the mRNA <br></br>E) is a purine- rich consensus sequence found in the 16S rRNA subunit
Answer: B
3) During translation initiation in bacteria, the amino acid on the initiator tRNA is ________. <br></br>A) N- formylmethionine (fMet)<br></br> B) IF- 1<br></br>C) methionine (Met)<br></br>D) added using ATP as the energy source <br></br>E) acetylated
Answer: A
4) Identification of ribosomal proteins involves two- dimensional gel electrophoresis, which separates the proteins on the basis of ________.<br></br>A) charge<br></br>B) mass and charge <br></br>C) C) folded shape<br></br>D) mass<br></br>E) mass, charge, and folded shape
Answer: B
5) How does the eukaryotic initiation complex locate the correct start codon?<br></br>A) The initiation complex moves the small ribosomal subunit through the 5ȝ UTR, scanning for the start AUG.<br></br>B) The correct start codon is the first ATG encountered downstream of the Kozak sequence.<br></br>C) The pre- initiation complex moves the ribosome through the 3ȝ UTR, scanning for the Kozak sequence.<br></br>D) The correct start codon is the formyl- ATG, which will encode for fMet in the protein.<br></br>E) The true start codon is the first ATG encountered downstream of the Shine- Dalgarno sequence.
Answer: A
6) What is the cellular location of the stages of translation in bacteria and eukaryotes? 6)<br></br>A) cytosol for bacteria and eukaryotes<br></br>B) membrane for bacteria and cytosol and rough ER for eukaryotes<br></br>C) cytosol for bacteria and cytosol, mitochondrion, and plastid for eukaryotes<br></br>D) nucleoid for bacteria and rough ER for eukaryotes E) cytosol for bacteria and nucleus for eukaryotes
Answer: C
7) How does the eukaryotic ribosomal small subunit recognize the start codon on the mRNA? <br></br>A) It binds an Met- tRNA to the first AUG codon it encounters.<br></br>B) It binds an Met- tRNA to the first AUG codon after the Kozak sequence.<br></br>C) It performs an ATP hydrolysis within the small subunit once it encounters a Met- tRNA already bound to the AUG.<br></br>D) It undergoes a conformational charge that recruits other proteins when it hydrogens bonds to the correct tri- nucleotide sequence.<br></br>E) It wraps the mRNA strand to bring initiation enhancer proteins into the vicinity of the start codon.
Answer: B
8) A tRNA in the P site of the ribosome will enter the ________ site after translocation of the ribosome.<br></br> A) A B) initiation C) řȝ D) śȝ E) E
Answer: E
śȝ GACCAUUUUUGA 3ȝ<br></br>If a tRNA with a Phenylalanine amino acid attached is in the P site of the ribosome, an empty tRNA present in the E site that delivered which amino acid?<br></br>A) serine<br></br>B) proline<br></br>C) aspartic acid<br></br>D) tyrosine<br></br>E) histidine
Answer: E
śȝ GACCAUUUUUGA 3ȝ<br></br>In the polypeptide produced, what amino acid will be attached to the amino group of the histidine encoded by this mRNA?<br></br>A) aspartic acid<br></br>B) proline<br></br>C) tyrosine<br></br>D) phenylalanine<br></br>E) serine
Answer: A
11) What would you expect to find bound to the stop codon at the A site?<br></br>A) a charged tRNA with the anticodon ATC<br></br>B) a charged tRNA with the anticodon TAG<br></br>C) an uncharged tRNA<br></br>D) a translation release factor<br></br>E) Nothing binds to a stop codon, which is why the peptide is released.
Answer: D
12) What is necessary for a eukaryotic RNA to be recognized and bound by the small subunit of the ribosome?<br></br>A) Sufficiently large 5’ UTR for ribosome scanning.<br></br>B) Presence of an AUG start codon near the 5’ end of the mRNA.<br></br>C) Formation of the pre- initiation complex before ribosome binding.<br></br>D) Presence of 5’ methyl- G cap on the mRNA.<br></br>E) Formation of the initiation complex before ribosome binding.
Answer: D
13) Elongation factors translocate the ribosome in the 3ȝ direction by a distance of ________. <br></br>A) one nucleotide<br></br>B) two nucleotides<br></br>C) two codons<br></br>D) one codon<br></br>E) three codons
Answer: D
A polycistronic mRNA contains multiple? <br></br>A) mRNAs<br></br>B) promoters<br></br>C) Kozak sequences<br></br>D) Shine- Dalgarno sequences<br></br>E) polypeptide- encoding sequences
Answer: E
15) Why are eukaryotic mRNAs not polycistronic, unlike some bacterial transcripts?<br></br>A) The eukaryotic ribosome must bind to the 5’ end of the mRNA and scan, while the bacterial ribosome can bind to a Shine- Delgarno sequence anywhere in the mRNA.<br></br>B) Bacteria couple their translation with transcription, while eukaryotes do not.<br></br>C) Eukaryote’s genetic code is non- overlapping, and so coding sequences cannot overlap on the same mRNA.<br></br>D) Eukaryotes have more complex translational machinery than bacteria that is also less efficient in initiating translation.<br></br>E) Eukaryotic mRNAs are generally shorter than bacteria mRNAs, and so do not contain sufficient information to encode additional polypeptides.
Answer: A
16) What does it mean for two codons to be synonymous?<br></br>A) They share one of the same nucleotides in their codon sequence.<br></br>B) They share two of the same nucleotides in their codon sequence.<br></br>C) They are adjacent on the mRNA.<br></br>D) They encode the same amino acid.<br></br>E) They occur in equal abundance in an mRNA sequence.
Answer: D
17) What result would you expect if a mutation eliminates one of the four arms of a tRNA? <br></br>A) The tRNA will not be recognized by tRNA synthetase and cannot be charged.<br></br>B) The tRNA will fit into the A site but will not release the peptide at the P site.<br></br>C) The tRNA will be charged with the wrong amino acid.<br></br>D) The tRNA will not be able to undergo traditional complementary base pairing.<br></br>E) There will be no effect on function, so long as the anticodon region is intact.
Answer: A
18) How many different aminoacyl- tRNA synthetases can be found in a given organism’s cells? <br></br>A) At least 20, or more depending on the organism<br></br>B) 16<br></br>C) 61<br></br>D) 20<br></br>E) The number varies greatly depending on the organisms type.
Answer: A
19) If a tRNA anticodon were mutated such that it no longer performed wobble, what would be the effect on encoded proteins?<br></br>A) A different amino acid would consistently replace the amino acid whose tRNA was mutated.<br></br>B) Many proteins would be truncated.<br></br>C) The rate of protein synthesis would be slowed.<br></br>D) Many proteins would have several mutated amino acids throughout their sequence.<br></br>E) The ribosome would be unable to translate proteins.
Answer: B
20) A mutagen has introduced a frame- shift mutation by adding one nucleotide base. Which of the following could be a reversion mutation for this particular mutant?<br></br>A) adding 1 base only<br></br>B) deleting 1 base or adding 1 base<br></br>C) deleting 1 base or adding 3 bases<br></br>D) deleting 2 bases only<br></br>E) deleting 1 base or adding 2 bases
Answer: E
21) Which of these choices represents one possible corresponding mRNA sequence that can be transcribe from the following DNA template?<br></br>śȝ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3ȝ<br></br>A) śȝ - ATG CGA TTT GGG TGC TAG - 3ȝ<br></br>B) śȝ - AUG CGA UUU GGG UGC UAG - 3ȝ C) śȝ - AUG CGA UUU GGG UGC - 3ȝ<br></br>D) řȝ - GGA CAU AGG UAC GUG GGU UUA GCG UAA UCC UG - 5ȝ<br></br>E) śȝ - CTA GCA CCC AAA TCG CAT TAG - 3ȝ
Answer: B
22) Given the following mRNA sequence, what is the amino acid sequence for the corresponding polypeptide?<br></br>śȝ - AUG CGA UUU GGG UGC UAG - 3ȝ<br></br>A) N-Arg- Phe- Gly- Stop-C<br></br>B) N-Met- Arg- Phe- Gly- Stop-C<br></br>C) śȝ- Met- Arg- Phe- Gly- Stop- řȝ<br></br>D) C-Met- Arg- Leu- Glu-N<br></br>E) N-Met- Asp- Phe- Gly- Trp-C
Answer: B
23) Given the following mRNA sequence, which of the following mRNAs would encode a protein with a different sequence of amino acids?<br></br>śȝ - AUG CAG UUA GCG UGC UAG - 3ȝ<br></br>A) śȝ - AUG CAG UUG GCG UGC UAG - 3ȝ<br></br>B) śȝ - AUG CAC UUA GCA UGC UAG - 3ȝ<br></br>C) śȝ - AUG CAG UUA GCA UGC UAG - 3ȝ<br></br>D) śȝ - AUG CAA UUA GCG UGU UAG - 3ȝ E) śȝ - AUG CAA UUA GCG UGC UAG - 3ȝ
Answer: B
24) Which mRNA below would code for a premature stop codon from the following amino acid sequence?<br></br>N—Met- Gln- Leu- Arg- Cys—C<br></br>A) śȝ - AUG AAG UUA GCG UGC UAG - 3ȝ B) śȝ - AUG CAG UUA GCG UGC AAG - 3ȝ<br></br>C) śȝ - AUG CAG UAA GCG UGC UAG - 3ȝ<br></br>D) śȝ - AUG CAG UUA UUG UGC UAG - 3ȝ E) śȝ - AUG CAG AUA GCG UGC UAG - 3ȝ
Answer: C
B) The mutation may have no effect on amino acid sequence.
C) The amino acid sequence would be changed.
D) A single extra amino acid would be present in the protein.
E) All of the above are possible outcomes.
A) It is likely nonfunctional, since bacteria use posttranslational cleavage of fMet to make
functional proteins.
B) It will be a functional bacterial protein, since all functional proteins must begin with fMet.
C) It will be not be able to be chemically modified, so it will be sent to the Golgi for secretion.
D) It will show improper protein sorting and will likely remain in the ER.
E) It will likely form a disulfide bond with a second peptide chain, forming a protein complex.
A) Hydrogen bonding between the ribosomal subunits and the mRNA creates the proper active site conformation to allow tRNA binding.
B) Complementary hydrogen bonding between tRNA and mRNA promote binding.
C) The amino acid on the tRNA recognizes the mRNA codon through hydrogen and ionic bonding.
D) Ionic bonds between the tRNA and the active site of the ribosomal subunits promote binding to the mRNA.
E) Appropriate shape of the tRNA allows it to fit onto the extended mRNA strand.
A) A missense mutation from one encoded amino acid changing to another.
B) It depends on what the changed nucleotide is.
C) A frameshift mutation for all of the subsequent amino acids in the protein.
D) No effect as the problem nucleotide would be corrected by RNA editing mechanisms.
E) A silent mutation and no change in the encoded amino acid.
A) DNA polymerase I
B) aminoacyl synthetase
C) aminoacyl peptidase
D) peptidyl transferase
E) DNA polymerase III
A) 10 B) 13 C) 8 D) 6 E) 4
