L5 - biological models

Question 1

Learning objectives of the lecture

Answer 1

1. Explain the emergence of anxiety and mood disorders from an evolutionary perspective [analyse].
2. Describe [paraphrase] the main research findings of genetics and environment in the development of anxiety and mood disorders and argue the strengths and weaknesses of different types of research [evaluate].
3. Describe the basic ideas of molecular mechanisms (genetics and epi-genetics) relevant to anxiety and mood disorders [paraphrase].
4. Summarize a vulnerability model of genetics and environment to anxiety and mood disorders [analyse].
5. Describe the critical neurotransmitter systems and their relationship to anxiety and mood disorders [paraphrase].
6. Explain the current state of affairs regarding antidepressants in the treatment of anxiety and mood disorders [paraphrase]: their effectiveness, the potential mechanisms, but also what is not yet known [analyse]

Question 2

Does nature or nurture cause mental disorders? What alternative debate about causes is a more useful approach?

Answer 2

Since both nature and nurture contribute to mental disorders, it’s more useful to consider ultimate vs proximal causes

Question 3

What are ultimate and proximal causes?

Answer 3

Picture 1

• Think of a timeline – ultimate very long time ago, proximal something more recent
• Ultimate cause: evolutionary cause that is also shaped by the environment – certain evolutionary pressures
• More proximal but more somewhere in the middle – available resources – stressors
• Afterwards parenting style – influence development of the brain, all interacting with genetics and environment
• Most proximal: social interactions, trauma
• Biology and environment (nature and nurture) are always together in all of those cases and steps in the timeline

Question 4

How do traits develop according to Charles Darwin?

Answer 4

Need some variation, reproductive benefit of that variation, pressures where these traits can be beneficial – certain traits can develop (e.g. long necks of giraffes)

Question 5

Do psychological mechanisms work in the same way as Darwin proposed about biological variation?

Answer 5

To some extent yes, for example experiencing negative emotions - in the case of fear
!But certainly not DSM diagnoses as they don’t have an evolutionary benefit

Question 6

Is there one ‘optimal adaptation’?

Answer 6

Optimal adaptation = refers to the idea of a single, best way for psychological mechanisms to function across all environments

• no universal optimal adaptation exists because the effectiveness of psychological traits depends on context and individual differences
• What is adaptive in one context may not be in another

Question 7

What role do emotions play in survival and how does that help explain that the adaptation depeds on context and individual differences?

Answer 7

• Emotions function as signal detection systems that help organisms identify and respond to fitness-relevant situations in their environment
  ↪ Based on Signal Detection Theory, which describes how systems (like our brains) balance the risk of false positives (responding to a non-threat as if it were a threat) and false negatives (failing to respond to an actual threat)
• Emotions trigger physiological, cognitive and behavioural changes that prepare an organism to respond
• Emotional systems have been shaped by natural selection to minimize the most costly errors
• Psychological mechanisms prioritize survival over accuracy = it’s safer to overreact (e.g., anxiety as a false alarm) than to miss real threats
  ↪ smoke detector principle = fear and anxiety are tuned to overreact because the cost of a false negative (failing to detect a real threat) is often much greater than the cost of a false positive (mistakenly perceiving a threat when there is none)
• Emotions regulate the allocation of cognitive and behavioral resources based on the expected risks and rewards in an environment

This whole thing is the idea of adaptive framework

Question 8

What does the extent to which psychological mechanisms are sensitive or alert to potential threats or stimuli depend on?

Answer 8

1. Probability of an event:
   ↪ If a threat is likely (e.g., encountering snakes in the wild), heightened alertness is more adaptive
   ↪ If the threat is unlikely (e.g., fearing snakes in a city like Amsterdam), this sensitivity may be less logical or useful.
2. False negatives (the cost of missing a real threat): the cost of not detecting a real danger can be severe (e.g., failing to notice a snake could lead to harm)
   ↪ In risky environments, the brain may prioritize avoiding false negatives by being extra cautious
3. False positives (the cost of wrongly identifying something as dangerous): the cost of mistakenly perceiving danger (e.g., thinking a rope is a snake) is usually minor.
   ↪ Over-alertness may cause unnecessary stress but is safer than missing a real danger
4. Changes in environment

Question 9

How do moods and emotions differ in their role of detection?

Answer 9

While acute emotions act as immediate detection mechanisms, mood serves as a longer-term integration system that adjusts detection thresholds based on past experiences

Question 10

How do rewards and punishments relate to the evolutionary fitness theory?

Answer 10

• punishments are stimuli that can be used to decrease the frequency of a behaviour
  ↪ things whose experience negatively covaries with fitness (toxins, isolation)
• Rewards are stimuli that can be used to increase the frequency of a behaviour
  ↪ things which positively covaries with fitness over evolutionary time (food, mates)
• natural selection will favour mechanisms that lead to strategies that maximize the capture of reward whilst minimising the exposure to punishment

Question 11

What is the two-dimensional framework which explains the reward and punishment threshold?

Answer 11

Picture 2 and 3

Threshold for responding to potential punishment (threat sensitivity):

• people witih a lower punishment threshold readily interrupt other activities to focus on potential dangers
  ↪ vigilance, sleeplessness, hyperarousal, and attentional biases towards threat cues leads to an anxious mood
• a higher threshold leads to a relaxed state and the behaviours mentioned above are missing

Threshold for responding to potential rewards (reward sensitivity):

• people with a lower reward threshold are ready to initiate in reward-approach behaviour when given only minimal cues that a reward might be available
  ↪ leads to an optimistic, motivated state, with attentional biases towards reward-related stimuli
• people with a higher reward threshold are more reluctant to o initiate reward-approach behaviour: they feel that it won’t be pleasurable, that they probably won’t succeed and that they don’t have the energy to try
  ↪ leads to a depressive state

Question 12

How can we use this framework to classify moods?

Answer 12

This framework allows for four major mood types:

1. Positive mood (high reward sensitivity, low threat sensitivity)
2. Anxious mood (high threat sensitivity, low reward sensitivity)
3. Depressed mood (low reward sensitivity, high threat sensitivity)
4. Relaxed state (low threat sensitivity, high reward sensitivity)

Question 13

How do thresholds and hence moods adapt based on past experiences over time?

Answer 13

Moods help adapt instead of resetting after each experience

1. Environmental predictability: today’s conditions predict tomorrow’s

• An individual who experiences a punishment sets a lower threshold for the detection of punishments in the next period of time, and an individual experiencing reward sets a lower threshold for the detection of reward in the next period of time
• a negative experience provokes an acute response (emotion, e.g. fear), but also an adjustment of expectations about future experiences

2. Individual differences: an individual’s physical condition affects the cost-benefit balance of actions

• If an organism is weak, it should be more cautious, leading to lower reward-seeking behavior and higher threat sensitivity

3. Environment & Condition interact: : bad experiences predict future risks and weaken the individual, making more adjustment critical

Moods help individuals survive by adjusting behavior based on past experiences

Question 14

What does then this adaptive mood model predict?

Answer 14

1. Environments with consistent rewards should foster an optimistic mood
2. Environments with frequent threats should induce anxiety
3. A resource-poor environment should lead to depressive-like states, reducing risk-taking behaviors

Question 15

What empirical evidence is there that supports this adaptive model?

Answer 15

1. Depression is often triggered by prolonged exposure to non-rewarding environments (e.g., unemployment, loss)
2. Anxiety is linked to past threats (e.g., exposure to danger leads to heightened threat detection)
3. Physical limitations (e.g., illness, malnutrition) correlate with both depression and anxiety
4. Animals also adjust their behavior based on prior experiences of threat and reward

Question 16

How does mood result in cognitive bias?

Answer 16

Mood influences how ambiguous stimuli are interpreted
Individuals in a depressed or anxious state tend to:

• Interpret ambiguous information negatively
• Focus more on threats than potential rewards
• Display cognitive biases in decision-making

Question 17

What empirical evidence is there that supports the cognitive bias in relation to mood?

Answer 17

1. Depressed individuals are more likely to interpret ambiguous faces as sad
2. Anxious individuals focus more on negative stimuli
3. Rats exposed to chronic stress are less likely to engage in reward-seeking behaviors

Such findings reinforce the argument that mood systems regulate behavior by adjusting decision-making thresholds

Question 18

What alternative function for mood disorders does the paper present?

Answer 18

Mood disorders are not necessarily malfunctions but extreme manifestations of adaptive processes:

• Depression might have evolved to reduce futile effort in harsh environments
• Anxiety could enhance survival in dangerous settings
• Comorbidity of anxiety and depression might be explained by the cumulative effect of negative experiences on both reward and threat sensitivity

Question 19

Why is this problematic in modern society?

Answer 19

However, while these mechanisms may be beneficial in ancestral environments, modern society presents mismatches:

• Chronic stressors (e.g., social isolation, economic hardship) can trigger prolonged mood responses that were originally designed for short-term environmental adaptation
• Modern treatments (e.g., antidepressants) often target the symptoms rather than the underlying adaptive function of mood

Question 20

Genetics overview

Answer 20

• Nuclei contains chromosomes
• Chromosome consists of Deoxyribo Nucleic Acid
• DNA consists of sugar-phosphate backbone + “base-pairs”
• Genes = sequence base pairs: ACTGGGCTACTACACAAACC
• sequence of base pairs becomes active when DNA is turned into RNA which codes for proteins
• Mutations can occur, and these are heritable
  ↪ most of the time all fine but some disorders stem from these mutations when they have negative effect

Question 21

What different methods are there in behavioural genetics?

Answer 21

1. Family studies
2. Adoption research
3. Twin research (very valuable)

• Monozygotic (MZ); 100% genetical identical
• Dizygotic (DZ); on average 50% genetical identical
• Twin studies compare the similarity between monozygotic (MZ, identical) twins and dizygotic (DZ, fraternal) twins to estimate genetic and environmental contributions to a trait

Question 22

What insight about heritability can we gain from twin studies?

Answer 22

Picture 10
Calculate correlations for MZ twins (rMZ) and DZ twins (rDZ).

• Correlation between how strong these disorder traits are related for the monozygotic and dizygotic twins – the relationship is stronger for monozygotic twins than dizygotic twins = indication of genetic component (if something is under genetic control, you would expect MZ to show stronger correlation than DZ)
  ↪ Any physical trait which has genetic component, the pattern will be the same, the strength might be different

Use these correlations to estimate:

• Additive genetic influence (A = 2(rMZ - rDZ))
• Common environment (C = rMZ - A)
• Unique Experience (or Error - variance that we can’t explain) (E = 1 - rMZ)

Heritability is a statistical estimate, not a direct measure of genetic influence

Example of anxiety and depression on picture 5

• Conclusion: partly heritable, partly unique experience

Question 23

Is enviornment also heritable?

Answer 23

Research shows that those areas are 6-39% heritable:

• Marital quality
• Social support
• Parental discipline and warmth
• Family environment
• Peer relationships
• One hypothesis on how environment can be heritable: the parental environment is actually similar across children (not always the case and lot of psychologists argue against this)

Genes and environment correlate

Question 24

What are the three gene - environment correlations?

Answer 24

Picture 5
Some genetic influences affect the type of environment a person is exposed to. These correlations can be:

1. Passive: a child inherits genes and is also raised in an environment influenced by parental genes (e.g., musically talented parents provide both musical genes and a musical home environment)
2. Reactive (evocative): certain genetic makeup and you show certain behaviour and the environment reacts to that (the things start to go together and the genetic makeup can fuel the environment’s response)
3. Active: individuals seek out environments that match their genetic predispositions (e.g., an athletic child chooses to play sports).

Core reason why it’s hard to tear apart the genes and environment when trying to figure out which causes what

Question 25

How do genetic predisposition interact with environmental factors and what moderates this interaction?

Answer 25

Genetic predispositions may interact with environmental factors to influence behavior, e.g. a person with a genetic risk for depression may only develop symptoms if they experience significant stress - Potential mechanism: **epigenetics** – changes in gene expression caused by environmental influences (e.g., stress, diet, trauma) without altering the DNA sequence ↪ environmental factors can turn genes "on" or "off," affecting behavior - There is an interaction of genotype and behaviour but it’s moderated by environment - Certain genetic makeup comes about in a different ways in different settings (the case with mapd) Picture 11

Question 26

What is the problem with gene-environment research?

Answer 26

It faces replication issues - major issue in behavioral genetics and psychology, as some gene-environment interactions may be harder to confirm than originally thought

Question 27

What is molecular genetics?

Answer 27

Focuses on mechanisms of genes at a biochemical level - how genes work within cells and how genetic variations contribute to traits and diseases

Question 28

What does the graph in picture 6 mean?

Answer 28

Shows relationbetween frequency of genetic variation occurring and effects of genes on psychiatric disorders (effect size) - Negative relationship – the more often a gene occurs, the less of an influence it has on a disorder – makes evolutionary sense - If a certain genetic makeup would be detrimental – wouldn’t make sense that it would occur a lot in general population – evolutionary perspective (not beneficial so wouldn't get selected)

Question 29

What are Manhattan graphs and what do they show?

Answer 29

Manhattan graphs: genetic contribution to disorder per chromosome - visualize genetic variants (SNPs) associated with a particular trait or disease - Y-axis: measure of effect size – the higher it is the more influence the genetic variant has on the disorder - Gives a nice intuition about the genetic makeup of mapd - There are **many genes** scattered around different chromosomes with lot of variation **that contribute to the disorders** = **polygenetic** effects - If only one chromosome – one dot and high up

Question 30

What neurotransmitter systems in the group mono-amines do we have?

Answer 30

1. Dopamine - Ventral Tegmenal Area 2. Norepinephrine - Locus Coeruleus 3. Serotonin - Raphe nucleus They are most closely related to the medications prescribed to the patients with mapd

Question 31

How do neurotransmitters work?

Answer 31

1. An electrical signal (action potential) travels down a neuron - neuron gets activated 2. At the end of the neuron, the signal triggers tiny sacs (vesicles) to release neurotransmitters into the gap between neurons (synaptic cleft) 3. The neurotransmitter crosses the gap and attaches to special receptors on the next neuron 4. Signal is passed on or blocked - depending on the neurotransmitter, the next neuron is either: → Excited (it continues the signal) → Inhibited (it stops the signal) 5. To prevent overstimulation, the neurotransmitter is removed by: → Reuptake (it’s taken back into the first neuron) → Breakdown (enzymes destroy it) → Diffusion (it drifts away)

Question 32

What is the history of psychopharmacology for MA(PD)?

Answer 32

1950s: Monoamine oxidase inhibitors (MAOIs) - Tricyclic antidepressants (TCAs) 1980s: Selective serotonin reuptake inhibitors (SSRIs) - Bupropion 1990s: Serotonin norepinephrine reuptake inhibitors (SNRIs) - Mirtazapine

Question 33

What is the historical perspective on antidepressant efficacy?

Answer 33

- Early Beliefs: In the past, it was believed that antidepressants were effective in about 70% of patients, while placebo worked in 30% - Initial Findings: Kuhn’s early trials with imipramine indicated that only patients with endogenous or melancholic depression were most likely to respond - Shift in Diagnostic Criteria: The introduction of DSM-III in the 1980s led to a broader definition of major depression, incorporating mild and moderate cases, which may have diluted antidepressant effects - Public domain FDA data revealed that symptom reduction was 40% with antidepressants and 30% with placebo, contradicting the earlier 70% efficacy claim. ↪ These findings suggest inflated expectations in early research

Question 34

What is the assumption about antidepressants and their effect on the neurotransmitters?

Answer 34

All antidepressants affect levels/activity of serotonin, norepinephrine and dopamine – influences the transmission from one synapse to another Therefore, disrubtance of chemical imbalance of depression = depression is a serotonin disorder

Question 35

Do we actually know how the effect of antidepressants is created on NT levels?

Answer 35

- Not enough evidence whether depression is related to high or low levels of neurotransmitters - Not clear how antidepressants work on NT levels - There are some theories (e.g. SSRI block serotonin reuptake so more NT) but we don’t know how it actually works

Question 36

What is a major problem with the use of antidepressants?

Answer 36

Even though we don’t know they are still being widely prescribed for many disorders - In Netherlands: >1.000.000 users - Prescribed for many different disorders, e.g. OCD, anxiety, personality disorders

Question 37

How do we measure whether antidepressants are effective?

Answer 37

Studied with randomized control trials (RCTs) – measure depressive symptoms pre and post and compared to placebo - pre-post score on depression rating scale (e.g. HAM-D) - the higher, the better (more symptom reduction) - This can be standardized (comparable for different symptom rating scales): Cohen’s D

Question 38

How effective antidepressants are?

Answer 38

- Effect size for depression and anxiety disorders, compare to placebo D = 0.3 (moderate effect) - But the total effect (not compared to placebo) is much larger: D = 0.8-1.4 This (might) explain why docters and researchers think differently about antidepressants… - Clinicians see the effectiveness of AD in clinical practice - but they are lacking the info on how would this client improve with a placebo **Critical note**: Consider the benefits of ADs compared to placebo

Question 39

How can we break down the effects of placebo and AD?

Answer 39

Picture 8 Natural course – people seek help when things are worst, things improve on their own The effectiveness of both is based on lot of things but the specific pharmacological effect of AD is just one of them and not even the biggest one

Question 40

Is placebo effect real? What are some importnat questions we have to ask ourselves?

Answer 40

- Not a biological active substance but it does have a biological effect → Brain scan shows some areas lighting up - the small drug-placebo differences is not unique to depression: illnesses that are chronic, have a fluctuating course and are associated with subjective distress are prone to placebo response (e.g. hypertension) - Previously thought that depressed patients would relapse quickly after placebo treatment - not so true they remain well for usually 6 mnths or longer - If it's effective, should it be prescribed to patients? Is it ethical? ↪ Still controversial, new research; open-labelled placebo might also work - Not as effective as psychotherapy - good to compare those two but difficult since psychotherapy is hard to be delivered as placebo

Question 41

Why has it taken so long to realise the caveats?

Answer 41

1. Still controversial to criticise AD 2. Publication bias - research is often funded by pharma companies which have something to lose (concern about possible false positive results - their trails may not be the best design and conduct)

Question 42

What are different forms of the publication bias?

Answer 42

1. Publication bias - Some studies are not published at all 2. Reporting bias - Some (negative) studies were published, but with suddenly positive results 3. Spin - some (negative) trials were published with negative results, but somehow still concluded that the drug is effective

Question 43

What is the problem with these forms of publication bias (and pb in general)? How does it then reflect on what studies get actually published?

Answer 43

Picture 9

Question 44

What is important to realise when it comes to the prescribing AD and why that might be dangerous?

Answer 44

SSRIs are not harmless drugs – that’s why it’s important to consider their effectiveness because the side effects are serious (mostly suicide which increases)

Question 45

How does the likelihood of active drug influence placebo response?

Answer 45

If the study has three arms: two active groups and one placebo group – the likelihood of getting the drug increases and the participants know this - Once the likelihood increases, the scores increase (higher values = bigger pre-post difference - better) - The more likely you are to get the treatment, the more you improve even if you get placebo - Also the difference between effectiveness of placebo and the drug decreases as the likelihood of getting the drug increases - Expectation effects - simply expecting an active treatment enhances response

Question 46

What is the 'mainstream' conclusion whether AD work?

Answer 46

→ “yes” (a bit) better compared to placebo (small effect, d ~ 0.3) ... Is this clinically relevant/significant? ...comparable to psychotherapy! (and combined it works better) The **use of** and **knowledge about** antidepressants is not balanced ## Footnote More positive conclusion

Question 47

However! We have to consider the 4 critical notes raised. What are they?

Answer 47

1. Consider the benefits of ADs compared to placebo 2. Publication bias 3. Side effects 4. Likelihood of active drug influences placebo response

Question 48

What is the 'critical' conclusion whether AD work?

Answer 48

Consider the critical notes and... - Placebo-run in phases: selection of patients in clinical trials who don’t respond to placebo - Effects of AD are only shown on short term ## Footnote So we're not really sure the effectiveness and actual benefits