Molecular genetics and biotechnology

Question 1

Every cell in your body contains the same genome. With this in mind, how is a brain cell different to a liver cell?

Answer 1

only about 1/2 to 2/3 of the genes in the genome get transcribed in each cell.

Approximately 10,000 of
the same genes are expressed.

These genes are needed for basic cellular functions.

1000 to 2000 expressed genes are unique to a specific cell type,

The different cell types express different transcription factors to ensure regulation of gene expression,

where the liver (for example) will have the appropriate transcription factors to transcribe glycogen synthase, but the brain will lack this transcription factor and therefore not make glycogen synthase.

Question 2

What would be the consequence of a failure to control gene expression?

Answer 2

Every cell would express all 21,000 protein coding genes.

No difference between different cell types.

This would not be compatible to life as a human. It would require far too much energy to be a viable process.

Question 3

Briefly outline the key regulatory elements of a gene.

Answer 3

The regulatory elements of a gene are found upstream of the coding region.

• contains important binding sites for key regulatory proteins.
• contains a promotor sequence; this is where the polymerase will bind.

- contains binding sites for
transcription factors (which act to activate gene expression) 

• sites for repressor proteins to bind (which act to repress gene expression).

Question 4

Promoter sequence in regulatory elements of a gene

Answer 4

where the polymerase will bind.

Question 5

transcription factors in regulatory elements of a gene

Answer 5

act to activate gene expression

Question 6

repressor protein in regulatory elements of a gene

Answer 6

act to repress gene expression

Question 7

what is an activator?

Answer 7

a protein that increases gene transcription of a gene or set of genes.

Most activators are DNA-binding proteins

Question 8

what is a repressor?

Answer 8

a DNA- or RNA-binding protein that inhibits the expression of one or more
genes by binding to the operator sequence or associated silencers.

A DNA-binding repressor blocks the attachment of RNA polymerase to the promoter, thus preventing transcription of the genes into messenger RNA.

Question 9

what is a transcription factor?

Answer 9

a protein that controls the rate
of transcription of genetic info from DNA to messenger RNA, by binding to a specific DNA sequence.

The function of TFs is to regulate—turn on and off—genes in order to make sure that they are expressed in the right cell at the right time and in the right amount throughout the life of the cell and the organism.

Question 10

What is an initiation complex and what is the importance of this complex?

Answer 10

a group of proteins that bind to the DNA regulatory sequences, forming a complex which is able to recruit RNA polymerase. This complex is only able to form if nothing is bound at the repressor site. This complex is important as without it,
RNA polymerase would not be able to bind to the promoter sequence and therefore, transcription would not be initiated.

Question 11

What is a signal transduction pathway?

Answer 11

transmission of molecular signals from a cell’s exterior to its interior.

Signals received by cells must be transmitted effectively into the cell to ensure an appropriate response. This step is initiated by cell-surface receptors.

The physical signal is
transmitted through a cell as a series of molecular events, most commonly protein
phosphorylation catalysed by protein kinases, which ultimately results in a cellular response.

Question 12

How does Leptin function to turn off insulin production and why is this important?

Answer 12

Leptin binds to leptin receptors on the surface of pancreatic b cells. This binding initiates a
cell signalling cascade, ultimately leading to the dephosphorylation of a repressor protein.

Once dephosphorylated, this repressor protein is able to bind to regulatory elements on the insulin gene, thus repressing transcription.

This is important to ensure the insulin is not produced in the fasting state, when it is not required. This ensures that adequate blood glucose concentration is maintained between meals.

Question 13

What are Mendel’s Laws of Inheritance?

Answer 13

segregation
independent assortment
dominance

Question 14

law of segregation

Answer 14

when gametes form. alleles separate so that each gamete carries only 1 allele for each gene.

Question 15

law of independent assortment

Answer 15

segregation of alleles for one gene occurs independently to that of any other gene.

Question 16

law of dominance

Answer 16

some alleles are dominant while others are recessive; an organism with at least 1 dominant allele will display the effect of the dominant allele

Question 17

What are alleles?

Answer 17

alternative form of a gene (one member of a pair) that is located at the same place on a chromosome.

Question 18

how are alleles inherited? And how are they important in making each individual unique?

Answer 18

Each gamete gets one copy of the chromosome, each with a unique combination of alleles.

Different alleles can result in different observable phenotypic traits, such as different pigmentation.

A notable example of this trait of colour variation is Gregor
Mendel’s discovery that the white and purple flower colours in pea plants were the result of “pure line” traits which could be used as a control for future experiments.

Question 19

What is the exception to Mendel’s law of independent assortment? What is the
consequence of this?

Answer 19

When 2 genes are close together on a chromosome (genetically linked)

as the alleles will often be inherited together.

Genetic linkage is a key principle in understanding the inheritance of traits. It explains why some characteristics always seem to occur together.

Question 20

what does homozygous mean?

Answer 20

both copies of a gene or locus match.

Two dominant alleles (AA) or two recessive alleles (aa) are
homozygous.

Question 21

what does heterozygous mean?

Answer 21

that the copies do not match.

One dominant allele and one recessive allele (Aa) is heterozygous.

Question 22

What is the importance of the phenylalanine breakdown pathway?

Answer 22

Phenylalanine (dietary protein) metabolic pathway yields tyrosine (Produce melanin pigments)

Defects of enzymes responsible for interconversion of metabolites in the pathway are the cause of single-gene Inborn Errors of Metabolism: Phenylketonuria (PKU), Albinism (Melanin deficiency), and Alkaptonuria (excess HA).

Question 23

what is phenylalanine?

Answer 23

primary amino acid that is abundant in dietary protein.

yield tyrosine

Question 24

what is tyrosine?

Answer 24

production of Melanin pigments.

Question 25

what is PKU?

Answer 25

caused by a defect in the gene that helps create the enzyme needed to break down phenylalanine. Without the enzyme necessary to process phenylalanine, a dangerous build- up can develop when a person with PKU eats foods that contain protein or eats aspartame, an artificial sweetener. This can eventually lead to serious health problems.

Question 26

For the rest of their lives, people with PKU — babies, children and adults — need to follow a diet that

Answer 26

limits phenylalanine, which is found mostly in foods that contain protein. Babies are screened for PKU soon after birth. Recognizing PKU right away can help prevent major health problems.

Question 27

What factors can alter an individual’s phenotype?

Answer 27

Genotype | Environment

Question 28

What factors can alter an individual’s phenotype? For example, if someone has the genotype for PKU, they can avoid the phenotype through

Answer 28

dietary modification. So, although they still do not have the enzyme allowing for phenylalanine to be broken down to tyrosine, due to diet modification, the disease phenotype can be avoided. The phenotype depends upon the genotype but can also be influenced by environmental factors.

Question 29

What is translation?

Answer 29

process in which ribosomes in the cytoplasm or ER synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus.

Question 30

why is translation important?

Answer 30

way in which a messenger RNA is decoded into proteins. Without translation, gene expression would not occur and no proteins would be made. This would not be conducive to life.

Question 31

What are the three phases of translation?

Answer 31

Initiation Elingation Termination

Question 32

what is Initiation in Translation?

Answer 32

The ribosome assembles around the target mRNA. The first tRNA is attached at the start codon.

Question 33

what is Elongation in Translation?

Answer 33

The tRNA transfers an amino acid to the tRNA corresponding to the next codon. The ribosome then moves (translocates) to the next mRNA codon to continue the process, creating an amino acid chain.

Question 34

what is Termination in Translation?

Answer 34

When a peptidyl tRNA encounters a stop codon, then the ribosome folds the polypeptide into its final structure.

Question 35

Translate this section of mRNA into its sequence of amino acids: GCCCAATACCTTGGCCCTTCTAGTT

Answer 35

Ala-Gln-Tyr-Leu-Gly-Pro-Ser-Ser

Question 36

What types of mutation may occur in DNA, leading to an alteration in the amino acid sequence?

Answer 36

Point mutation - Change of 1 letter Frameshift mutation - loss of 1 letter Frameshift mutation - gain of 1 letter

Question 37

What is MODY?

Answer 37

Maturity onset diabetes of the young and refers to any of | several hereditary forms of diabetes mellitus

Question 38

what types if mutation may occur to cause MODY?

Answer 38

mutations in an autosomal dominant gene disrupting insulin production.

Question 39

MODY is often referred to as

Answer 39

monogenic diabetes to distinguish it from the more common types of diabetes (type 1 and type 2), which involve more complex combinations of causes involving multiple genes and environmental factors. MODY 2 and MODY 3 are the most common forms.

Question 40

Some examples of genes that be mutated to cause MODY: MODY1 - MODY2 - MODY4 -

Answer 40

mutation in the gene hepatocyte nuclear factor 4a - mutation in the gene glucokinase - mutation in the gene for inulin promotor factor 1

Question 41

How can PCR be used in genetic testing, and how are the results analysed? Testing for MODY2

Answer 41

Glucokinase gene will be amplified from the patient. The DNA can then be run on agarose DNA gels, in which an electric current is passed through the gel. As DNA is negatively charged, it will run towards the positive electrode. The distance through the gel that the DNA runs is a function of its size. Small bits of DNA will run further through the gel than large pieces of DNA.

Question 42

PCR can be used to

Answer 42

amplify a specific DNA sequence, based on the design of highly specific primers (for example, primers that bind to the start of the glucokinase gene). This allows for a specific amplification of a short DNA sequence in questions.

Question 43

How can PCR be used in genetic testing, and how are the results analysed? testing for huntingtons disease

Answer 43

If a genetic disorder is caused by a very large insertion into the gene (for example in Huntington’s disease), then when the DNA of a patient with the disease is run on the gel, it will not migrate as far through the gel as someone without disease.

Question 44

PCR and hows its used in the case of MODY2?

Answer 44

the specific mutation in the gene introduces a restriction enzyme site that is recognised by the restriction enzyme HINDIII. So, if the glucokinase gene of a patient with MODY2 is incubated with HINDIII, then it will be cut into two pieces. So, when run on an agarose gel alongside the DNA of someone without the mutation, there will now be two distinct bands instead of one, thereby confirming the diagnosis of MODY2.

Question 45

what is Germline mutation?

Answer 45

If a mutation occurs in a cell that go on to make gametes (egg or sperm cells), the mutation can be passed on to the next generation (e.g. in born errors of metabolism).

Question 46

what is Somatic mutation?

Answer 46

occur in other cells and cannot be passed on – can result in caner.

Question 47

What is cancer?

Answer 47

- collection of related diseases. - some body’s cells begin to divide without stopping and spread into surrounding tissues. - start almost anywhere in the human body, which is made up of trillions of cells. - When cancer develops, cells become more abnormal, old or damaged - cells survive when they should die, and new cells form when they are not needed. - extra cells can divide without stopping and may form growths called tumours.

Question 48

Generally, is cancer a result of a single mutation or an accumulation of many mutations?

Answer 48

An accumulation of many mutations.

Question 49

why is cancer a result of An accumulation of many mutations?

Answer 49

In order for cancer to develop, must have accumulated a mutation in an - oncogene (just one copy needs to be mutated, i.e., oncogene mutations are dominant as they lead to a gain of function) - and mutations in both copies of a tumour suppressor gene (both copies of the gene need to be mutated i.e., tumour suppressor gene mutations are recessive as they lead to loss of function). These mutations must be in the same cell. This is to say that if you have a cancer contributing mutation to an oncogene in the liver, and a cancer contributing mutation in a tumour suppressor gene in the heart, you will not get cancer. The mutations both need to be in the liver, for example.

Question 50

oncogenes mutations

Answer 50

dominant | gain of function

Question 51

tumour suppressor gene mutations

Answer 51

recessive | loss of function

Question 52

What is a carcinogen?

Answer 52

any substance, radionuclide, or radiation that promotes carcinogenesis, the formation of cancer. This may be due to the ability to damage the genome or to the disruption of cellular metabolic processes.

Question 53

What does it mean if someone has a genetic predisposition (genetic susceptibility) to cancer?

Answer 53

is an increased likelihood of developing a particular disease based on a person's genetic makeup. results from specific genetic variations that are often inherited from a parent. These genetic changes contribute to the development of a disease but do not directly cause it. Some people with a predisposing genetic variation will never get the disease while others will, even within the same family.

Question 54

Some people with a predisposing genetic variation will never get the disease while others will, even within the same family. Example

Answer 54

certain mutations in the BRCA1 or BRCA2 genes greatly increase a person's risk of developing breast cancer and ovarian cancer. So, in this instance, these people have inherited the mutation in the oncogene, so now only require a recessive mutation to the tumour suppressor gene. Thus greatly increasing their likelihood of developing cancer.

Question 55

What are tumour suppressor genes?

Answer 55

are genes whose protein products are involved in the inhibition of cell proliferation.

Question 56

What are tumour suppressor genes normal role example?

Answer 56

ensure that transcription | factors involved in the transcription of proliferation genes are held inactive in the cytoplasm of the cell.

Question 57

what is the | consequence of mutation to tumour suppressor genes?

Answer 57

cause a loss or reduction in its function, the cell can | progress to cancer, usually in combination with other genetic changes.

Question 58

What are oncogenes?

Answer 58

often code for proteins that stimulate cell division.

Question 59

what are oncogenes normal role?

Answer 59

Essential for normal growth, development and the maintenance of healthy organs and tissues. function in a very tightly regulated fashion, only active in their ability to upregulate cell division when the cell receives the proper signals.

Question 60

what is the consequence of | mutation to oncogenes?

Answer 60

leads to a gain of function, oncogene now upregulates cell division much more than it should and that it’s activity in doing so is now unregulated. contributes to the development of cancer, when such mutations are found in combination with mutations to tumour suppressor genes.

Question 61

Chronic myeloid leukaemia (CML)

Answer 61

cancer of blood cells, characterized by replacement of the bone marrow with malignant, leukemic cells. Many of these leukemic cells can be found circulating in the blood and can cause enlargement of the spleen, liver, and other organs.

Question 62

The most common oncogene mutation

Answer 62

Philadelphia chromosome. The Ph chromosome is the result of a translocation—or exchange of genetic material—between the long arms of chromosomes 9 and 22 . This exchange brings together two genes: the BCR (breakpoint cluster region) gene on chromosome 22 and the proto-oncogene ABL (Ableson leukaemia virus) on chromosome 9. The resulting hybrid gene BCR-ABL codes for a fusion protein with tyrosine kinase activity, which activates signal transduction pathways, leading to uncontrolled cell growth.

Question 63

BCR-ABL codes for a

Answer 63

fusion protein with tyrosine kinase activity, which activates signal transduction pathways, leading to uncontrolled cell growth.

Question 64

There are many different tumour suppressor gene mutations that may contribute to CML, including mutations to

Answer 64

p53, RB, or p16.

Question 65

the RB protein functions

Answer 65

constrain a transcription factor for cell division genes in the cytosol of the cell. If the RB gene mutates that reduce or abolish its ability to do this, then the transcription factor has unregulated access to the nucleus, and an unregulated ability to transcribe the cell division genes.

Question 66

What methods are currently used to treat cancer?

Answer 66

Surgery, radiation therapy, chemotherapy.

Question 67

What are recombinant DNA technologies?

Answer 67

joining together of DNA molecules from two different species. These are then inserted into an organism to produce (express) a useful protein.

Question 68

Describe the use of plasmids in recombinant DNA technologies?

Answer 68

Plasmids are used in genetic engineering to reproduce recombinant genetic material. When a plasmid is inserted into a bacterium, the bacterium is encouraged to multiply, creating more copies of the recombinant DNA.

Question 69

The key components of the plasmid are

Answer 69

Origin of replication (ORI) - allows initiation of replication using host DNA polymerase Antibiotic resistance gene - allows selection of cells containing plasmid promoter - drives expression of your favour gene (eg insulin or GFP) in cells with appropriate transcription factor machinery.

Question 70

Origin of replication (ORI)

Answer 70

allows initiation of replication using host DNA polymerase

Question 71

Antibiotic resistance gene

Answer 71

allows selection of cells containing plasmid

Question 72

promoter

Answer 72

drives expression of your favour gene (eg insulin or GFP) in cells with appropriate transcription factor machinery.

Question 73

what are restriction enzymes?

Answer 73

a protein produced by bacteria that cleaves DNA at specific sites along the DNA molecule. In the bacterial cells, restriction enzymes cleave foreign DNA, thus eliminating infecting viruses (for example). In the laboratory they are used to manipulate fragments of DNA, and are indispensable tools in recombinant DNA technologies.

Question 74

what are ligase?

Answer 74

– a specific type of enzyme that facilitates the joining of DNA strands together by catalysing the formation of a phosphodiester bond.

Question 75

what are restriction enzymes and ligases uses in recombinant DNA technologies?

Answer 75

cutting and pasting our gene of interest into the bacterial plasmid.

Question 76

What is transformation?

Answer 76

Transfer of plasmids into bacteria.

Question 77

What are the main issues likely to arise when using a prokaryotic gene system to clone eukaryotic genes?

Answer 77

Prokaryotes - don't have enzymes to do post-translational modifications - incorrect protein folding - unable to splice introns Prokaryotes do not have the enzymes to do the types of post-translational modifications required for human proteins. By using eukaryotic cells, the appropriate modifications can be added to the protein, ensuring optimum biological function. In prokaryotic systems, protein folding isn't ideal, and correct folding can be improved by using eukaryotic cells. Prokaryotic cellular machinery is also unable to splice introns out of a gene sequence, so, if the gene of interest contains introns, these will be incorporated into the final protein product, thereby producing a non-functional protein. This can be overcome by using cDNA, which does not contain introns as it has been reverse transcribed from mRNA.

Question 78

Outline the key steps in producing a recombinant protein.

Answer 78

1. Isolate gene of interest 2. clone into expression plasmid 3. Transform into bacteria for expression or isolation of more DNA for use in another expression system 4. Grow cells expressing protein of interest 5. Isolate and purify the protein

Question 79

Using the steps outlined above, briefly discuss the production of recombinant human insulin. Isolate gene of interest

Answer 79

Isolate human insulin mRNA and reverse transcribe into cDNA. Cleave the A chain and B chain sequences from each other.

Question 80

Using the steps outlined above, briefly discuss the production of recombinant human insulin. clone into expression plasmid

Answer 80

Clone the A chain into one plasmid and the B chain into another plasmid. The plasmids will both contain the lac Z gene upstream of the insulin chain sequence, to act as a reporter gene.

Question 81

Using the steps outlined above, briefly discuss the production of recombinant human insulin. Transform into bacteria for expression or isolation of more DNA for use in another expression system

Answer 81

Transform these two plasmids into different cultures of bacteria.

Question 82

Using the steps outlined above, briefly discuss the production of recombinant human insulin. Grow cells expressing protein of interest

Answer 82

Grow the two populations of cells, allowing them to express lac Z/insulin A fusion protein or the lac Z/insulin B fusion protein.

Question 83

Using the steps outlined above, briefly discuss the production of recombinant human insulin. Isolate and purify the protein

Answer 83

Isolate the expressed proteins from the cultures, treat with cyanogen bromide to cleave the A and B chains off the lac Z protein. Purify, and mix the two purified protein samples together, place under oxidising conditions, allowing active insulin to be formed.

Question 84

What are the advantages of using a prokaryotic system?

Answer 84

low cost, high yield, pathogen free

Question 85

What are the disadvantages of using a prokaryotic system?

Answer 85

proteins often partially folded, inability to perform post-translational modifications.

Question 86

What are the benefits of using eukaryotic cells instead of prokaryotic cells for the production of therapeutic proteins?

Answer 86

Prokaryotes do not have the enzymes to do the types of post-translational modifications required for human proteins. - using eukaryotic cells, the appropriate modifications can be added to the protein, ensuring optimum biological function. Another advantage is that often in prokaryotic systems, protein folding isn't ideal, and - correct folding can be improved by using eukaryotic cells.

Question 87

Erythropoietin (EPO)

Answer 87

hormone produced by the kidney that promotes the formation of RBC by the bone marrow. The kidney cells that make erythropoietin are sensitive to low oxygen levels in the blood that travels through the kidney. These cells make and release erythropoietin when the oxygen level is too low.

Question 88

why is a recombinant EPO produced?

Answer 88

use as a therapeutic agent by recombinant DNA technology in CHO cell culture, they are used in treating anaemia resulting from chronic kidney disease, chemotherapy induced anaemia in patients with cancer, inflammatory bowel disease

Question 89

How is this recombinant EPO | misused?

Answer 89

blood doping agent by endurance athletes, as a | means by which to increase RBC production, thereby increasing the oxygen carrying capacity of the blood.

Question 90

What is the concept of “Pharming”?

Answer 90

use of animals to make recombinant human proteins for the treatment of human disorders. Using such systems has the benefit of ensuring that the proper post-translational modifications are able to occur.

Question 91

What is gene therapy?

Answer 91

when DNA is introduced into a patient through the use of viral vectors, to treat a genetic disease. The newly introduced DNA usually contains a functioning copy of the gene to correct for the effects of a disease-causing mutation. Gene therapy has the potential to cure disease in a one off treatment.

Question 92

Type I diabetes

Answer 92

occurs as the beta cells of the pancreas as destroyed and can no longer produce insulin.

Question 93

How could gene therapy be used as a potential cure for Type I diabetes?

Answer 93

take the human insulin gene, and with the use of a viral vector, insert this gene into the liver to turn the liver into an “insulin making machine”

Question 94

The problem is that we do not want insulin to be produced in the liver constantly, why is this a problem? How to solve problem?

Answer 94

lead to type II diabetes. Design the vector, we can fuse the pre-pro insulin gene to a glucose sensitive promotor, so that insulin will only be produced when glucose levels rise. As is the case with pancreatic insulin production.

Question 95

Define CRISPR-Cas, including where this system | originates, and outline how this system works.

Answer 95

CRISPR-Cas is a technology to edit parts of the genome by removing, adding, or otherwise altering sections of DNA (for example, a mutation may be removed, and the correct sequence of DNA put in its place). This system was discovered in bacteria, where it is used as a defence system against bacteriophages.