Transkripsjon, aminosyreskiftet Flashcards Preview

Cellebiologi > Transkripsjon, aminosyreskiftet > Flashcards

Flashcards in Transkripsjon, aminosyreskiftet Deck (29):
1

Skisser oppbygningen av et eukaryot gen som koder for et protein og forklar hvordan det transkriberes.

Hovedstrukturen til proteinkodende gener hos eukaryoter består av promoter, transkripsjonsstart, exoner, introner og transkripsjonsstopp. Innenfor exonsekvensene finner vi sekvenser som koder for 5'og 3' ikke- translaterende områder, samt sekvensene som gir opphav til den åpne leserammen som koder for selve proteinet. Transkripsjonen deles i 3 hovedfaser (initiering,!elongering!og!terminering). Initiering: RNA polymerase II binder seg til promoter ved hjelp av transkripsjonsfaktorer. Det dobbelttrådige DNA åpnes. Elongering: RNA polymerase II starter ved transkripsjonsstart og syntetiserer et enkelttrådig primærtranskrop for mRNA (i 5'-3' retning) på grunnlag av DNA-sekvensen i 3'-5' retning. Terminering: Dette skjer ikke på et eksakt definert sted i eukaryote celler. termineringssetet kan variere flere tusen baser for primærtranskript fra ett og samme gen. Stopper nedenfor et polyadenyleringssignal.

2

Gjør rede for spleisingen av et primærtranskript for mRNA.

Her forventes det at de fleste/alle beskriver spleising av et primærtranskript for mRNA: Med spleising menes fjerning av intronsekvenser. Prosessen foregår i cellekjernen og utføres av spleisosomer, som består av protein; og RNA;komplekser. RNA;molekylene er relativt korte og betegnes U1, U2, osv. Noen av dem hjelper til med gjenkjenning av ekson/intron;overgangene. For hvert enkelt intron som ; ;spleisesetet i intronet. Prosessen begynner vanligvis med intron 1, der ; ;enden av ; ;spleisesetet blir kuttet og ekson 1 og 2 blir bundet direkte sammen. Tilsvarende fjernes påfølgende introner.

3

Gjør rede for modifiseringen (capping) av 5' enden av et mRNA i eukaryote celler. Hvilken funksjon mener man denne modifiseringen har?

mRNA blir modifisert i sin 5' ende like etter at transkripsjonen har startet. Til det første nukleotidet i mRNA skjer det en påhektet en ekstra GMP i motsatt retning av normalt (5'-5'). Videre skjer det en metylering sv denne G'en. Det er tre enzymer som er involvert i capping prosessen: fosfatase, guanyl transferase og metyl transferase. Det forventes ikke at studentene skal navngi disse. 5' cap-strukturen mener man har betydning for:
enden av mRNA mot nedbrytning av fosfataser og nukleaser.
muligens for eksport av mRNA ut av cellekjernen
binding av mRNA til ribosomsubenhet i cytosol og initiering av proteinsyntese

4

Skissér oppbygningen av et ferdig bearbeidet mRNA i eukaryote organismer.

5' cap, 5' ikke translaterende del, åpen leseramme, 3' ikke translaterende del, poly A hale.

5

Gjør rede for hvordan alternativ spleising kan gi opphav til forskjellige mRNA som koder for ulike proteiner med forskjellig funksjon.

Et primærtranskript blir dannet av RNA polymerase II. Hvis dette primærtranskriptet kan bli spleiset på forskjellige måter, kan det oppstå forskjellige mRNA. Hvis disse forskjellene omfatter den åpne leserammen, fåes forskjellig aminosyresekvens og dermed mulighet for endret funksjon.

6

Beskriv oppbygningen av et eukaryot ribosom. Hvor og hvordan dannes et eukaryot ribosom?

Kandidatene bør ha med følgende om oppbygningen av et eukaryot ribosom: Består av en liten subenhet (40S) og en stor subenhet (60S); til sammen utgjør de et ribosom på 80S. Den lille subenhet består av en rekke proteiner og 18S rRNA. Den store subenhet består av en rekke proteiner og 5S, 5,8S og 28S rRNA. Ribosomet har et E, P og A-sete. Kandidatene bør ha med følgende om dannelsen av et eukaryot ribosom: Ribosomene dannes i nucleolus i cellekjernen. rRNA og ribosomale proteiner danner den lille og store ribosom subenheten. Hver enkelt subenhet dannes og transporteres hver for seg ut gjennom kjerneporene og ut til cytosol.

7

Beskriv hvordan glutamat og glutamin brukes til å fjerne hjernens overskudd av NH3.

I hjernen skjer dette ved reaksjon katalysert av glutamin syntetasen som gir ATP, avhengig syntese av Gln:
Glutamat + ATP + NH3 -> Glutamin + ADP + Pi

Gln skilles ut i blod, og er derfor den aminosyren det er mest av i blodet. Gln tas opp av tarm, nyrer og lever, der Gln blir substrat for glutaminase: Glutamin -> Glutamat + NH3. I leveren vil NH3 videre metaboliserer til urea.

8

Når et voksent individ har et kosthold som inneholder for lite fenylalanin viser det seg at tyrosin blir en essensiell aminosyre. Hvorfor? Begrunn ditt svar.

Fenylalanin er en essensiell aminosyre, men samtidig også forløper for tyrosin, dvs. hydroksylering av Phe katalysert av fenylalanin hydroksylase resulterer i Tyr. Mangel på Phe medfører derfor at Tyr blir essensiell. Tetrahydrobiopterin er nødvendig koenzym for hydroksyleringen.

9

Skisser sammenhengen mellom alanin, aspartat, glutamat og sitronsyresyklus. Beskriv i ditt svar kort de impliserte reaksjoner, og angi hvilke koenzymer som måtte være nødvendige.

Alanin+ ketoglutarat -> Pyruvat + Glu (ALAT)
Pyruvat + NAD+ +CoA -> Acetyl CoA + CO2 + NADH H+ (Pyruvat dehydrogenase)
Asp + a ketoglutarat -> oksaloacetat +Glu (ASAT)
Glu + NAD(P)+ -> a ketoglutarat + NAD(P)H H+ (Glu dehydrogenase)
Alanin aminotransferase (ALAT) og aspartat aminotransferase (ASAT) er aminotransferaser og krever pyridoksal;fosfat (fra vitamin B6) som koenzym. For Ala går forbindelsen til sitronsyresyklus også via pyruvat DH, reaksjonen som krever flere koenzymer (alle med opphav i et B;vitamin); NAD+, FAD, lipoinsyre, tiaminpyrofosfat. Glu DH kan anvende både NAD+ og NADP+ som koenzym.

10

Hos mennesket er genet for HMGJCoA reduktase lokalisert til kromosom 5 og består av 20 exoner. Det er blitt beskrevet tilfeller av alternativ spleising av primærtranskriptet til enzymet. De første 21 basene i den åpne leserammen er 5'auguugucaagacuuuuucga3'

Hvordan foregår dannelsen av primærtranskriptet og hvilket enzym katalyserer reaksjonen?

Dannelsen av primærtranskriptet kan deles inn i initiering, elongering og terminering. Initiering: Generelle transkripsjonsfaktorer binder seg til promoter-regionen. RNA-polymerase II binder seg. DNA dobbelhelixen åpnes. RNA;polymerase II fosforyleres på sin C-terminal ende. DNA tråden leses i 3'-5' retning og det syntetiseres en RNA tråd i 5'-3' retning. Elongering: RNA polymerase II katalyserer følgende reaksjon:
RNAn + NTP -> RNAn+1 + PPi
Både exon- og intronsekvenser av DNA blir lest og primærtranskriptet inneholder derfor både exon; og intronsekvenser. Terminering: Det er i det eukaryote system ikke en vel definert terminering av primærtranskriptet. RNA;polymerase II stopper transkripsjonen i et område på ca. 2000 baser etter et polyadenyleringssignal.

11

Hvor i cellene foregår spleisingen og hvordan skjer den? Hva menes med alternativ spleising?

Her forventes det at studentene beskriver spleising av et primærtranskript for mRNA: Med spleising menes fjerning av intronsekvenser. Prosessen foregår i cellekjernen og utføres av spleisosomer, som består av protein, og RNA-komplekser. RNA-molekylene er relativt korte og betegnes U1, U2, osv. Noen av dem hjelper til med gjenkjenning av ekson/intronovergangene. For hvert enkelt intron som fjernes gjenkjenner deler av spleisosomet først 5' spleisesetet og en adenin i forgreiningspunktet et stykke fra 3' spleisesetet i intronet. Prosessen begynner vanligvis med intron 1, der første trinn er kutting av esternindingen i 5' spleisesetet. Den frigjorte fosfatgruppen 5'-enden av intronet danner i stedet esterbinding til adenosingruppen i forgreningspunktet. Foruten C5' og C3' fosfodiesterbindingene får adenosingruppen her en tredje fosfodiesterbinding til C2 slik at det dannes en "lasso". Deretter skjer det en ny reaksjon der 3'-spleisesetet blir kuttet og ekson 1 og 2 blir bundet direkte sammen. Tilsvarende fjernes påfølgende introner.
Alternativ spleising er en prosess som forekommer i eukaryote celler hvor pre;Mrna (primærtranskriptet) fra et gen leder til forskjellige modne mRNA molekyler på grunn av bruk av forskjellige exoner i spleiseprosessen. Hvis disse forskjellene i det modne mRNA omfatter den åpne leserammen, fåes forskjellig aminosyresekvens og dermed mulighet for endret funksjon av proteinet.

12

Benytt den vedlagte tabellen (Vedlegg 1) over den genetiske kode til å angi de 7 første aminosyrene til HMGVCoA reduktasen.

Met Leu Ser Arg Leu Phe Arg M L S R L F R

13

Beskriv oppbygging av et eukaryot gen som gir opphav til et mRNA.

Hovedstrukturen til proteinkodende gener hos eukaryoter består av promoter, transkripsjonsstart, exoner, introner og transkripsjonsstopp. Innenfor exonsekvensene finner vi sekvenser som koder for 3'-5' ikke translerende områder, samt sekvensene som gir opphav til den åpne leserammen som koder for selve proteinet.

14

Gjør rede for generelle prinsipper ved transkripsjonsregulering av gener som koder for mRNA i eukaryote celler.

Først må DNA gjøres klart til transkripsjon. Dette kan innebære prosesser som nucleosom "unfolding", kromatin dekondensering, demetylering av DNA og histon-acetylering. Etter at dette har skjedd kan spesifikke regulatoriske proteiner binde seg til DNA. Disse spesifikke proteinene binder seg til promotere og regulatoriske DNA sekvenser, og vil i samarbeid med RNApolymerasen påvirke/regulere transkripsjonen.

15

Beskriv hovedtyper RNAVmolekyler som finnes i eukaryote celler, og angi deres funksjoner.

Vi har 5 hovedtyper RNA-molekyler i eukaryote celler: rRNA, mRNA, tRNA, snRNA og miRNA. Syntese av disse RNA molekylene skjer i forbindelse med prosessen transkripsjon ved hjelp av enzymene RNA polymeraser. RNA polymerase I syntetiserer rRNA. RNA polymerase II syntetiserer mRNA (og enkelte snRNA). RNA polymerase III syntetiserer tRNA, 5SrRNA og enkelte snRNA. Hovedfunksjonen til rRNA er å danne strukturen til ribosomene. Hovedfunksjonen til mRNA er å være budbringer av genetisk informasjon, og å påse at den genetiske informasjonen i exonene overføres til en bestemt aminosyresekvens. Hovedfunksjonen til tRNA er å transportere aminosyrer og i samarbeid med mRNA påse at den genetiske informasjonen i exonene overføres til en bestemt aminosyresekvens. Hovedfunksjonen til snRNA er å være en del av spleisosomet og delta i spleisingen av exoner (fjernelse av intronsekvenser i proteinkodende gener). miRNAs er RNA-molekyler som består av 21-24 nukleotidet og som binder seg til mRNA og regulerer genuttrykk på translasjonsnivå.

16

Glutamin syntetase katalyserer følgende reaksjon: Glutamat +NH4+ + ATP Glutamin + ADP + Pi.
Beskriv glutaminets funksjon som transportør av N-overskudd.

Leveren er eneste organ som har ureasyntese. Fra perifere organer (for eks. CNS) må overskudd av N transporteres til lever for ureasyntese. Fordi NH3 (NH4+) er toksisk er dette uaktuelt for transport. Overskudd av NH3 brukes derfor som substrat for glutamin syntetase, og transporteres som glutamin via blodbanen til for eks lever. I leveren tilbakedannes glutamine til glu + NH3 ved hjelp av glutaminase . Frigjordt NH3 inngår i leverens ureasyntese. Dersom nyre og tarm også nevnes som mottaker vev for gln er det korrekt. Her foregår det ikke urea syntese.

17

a. Urea dannes ikke direkte ved hydrolyse av ornithin.

Urea spalter hydrolyse av arginin. L ornithin et reaksjonsprodukt.

18

Hvor foregår urea syklus

Mellom cytosol og mitokondriell matriks. Syntese av karbomoylfosfat og citrullin skjer i mitokondriell matriks

19

De to N-atomene som inngår i urea tilføres ureasyklus fra?

De kommer fra karbomoylfosfat og L aspartat

20

Manglende argininosuccinat lyase aktivitet gir NH3 forgiftning.

Enzymet er nødvendig for ureasyklus. Mangler dette enzymet aktivitet blir det ikke dannet urea, og NH3 forgiftning vil bli konsekvensen.

21

GPR54-genet inneholder 5 exoner, og gir et primærtranskript som består av 3674 baser. Etter posttranskripsjonelle modifikasjoner har mRNA en størrelse på 1650 baser. Den åpne leserammen på mRNA er på 1197 baser, inklusive stoppkodon for translasjon. Beskriv tre posttranskripsjonelle modifikasjoner av et primærtranskript.

Studentene skal her beskrive følgende prosesser: Capping, spleising og påhekting av poly A hale

22

Hvor mange aminosyrer består proteinet av som kodes for av mRNA for GPR54?

398

23

De 12 første aminosyrene i den åpne leserammen 5'AUGCACACCGUGV 3'. Benytt det vedlagte kartet over den genetiske kode (vedlegg 1) og angi hvilke aminosyrer disse 12 basene koder for.

Met His Thr Val

24

Hvilken reaksjon katalyserer thymidylat syntasen, og hvilke medikamenter kan påvirke denne reaksjonen, direkte og indirekte?

Figur 22.23 fra Biochemistry (Lippincott's Illustrated Reviews) beskriver reaksjonen som katalyseres av thymidylatsyntasen. 5;Fluorouracil påvirker reaksjonen direkte, methotrexat påvirker reaksjonen indirekte.

25

Beskriv reaksjonen som katalyseres av RNAVpolymerase II.

RNA-polymerase II syntetiserer blant annet mRNA primærtranskriptet. Dette skjer ved at RNA polymerase II syntetiserer en tråd i 5'-3' retning ved å lese den ene DNA-tråden i 3'-5' retning. Reaksjonen som katalyseres kan beskrives på følgende måte:
RNA(n) + NTP -> RNA(n+1) + PPi, hvor NTP er enten ATP, GTP, CTP eller UTP

26

Gjør rede for bindingen av RNAVpolymerase II til en promoterregion.

Generelle eukaryotiske transkripsjonsfaktorer (TF, proteiner) binder seg med ikke kovalente bindinger til DNA consensus sekvenser i promoterregionen. Det kreves ikke at studentene navngir de forskjellige transkripsjonsfaktorene eller konsensussekvensene. Etter at en rekke generelle transkripsjonsfaktorer har bundet seg til promoterregionen, binder RNA polymerase II seg til disse.

27

Når aminosyrenes karbonskjeletter forbrukes, er syntese av urea også nødvendig. Begrunn utsagnet.

Alle aminosyrer innenholder en eller flere aminogrupper. Skal en aminosyre kataboliseres må a aminogruppen fjernes ved hjelp av en aminotransferase. Det oppstår derfor et nitrogenoverskudd, dvs. det vil foreligge aminogrupper som kroppen ikke har bruk for. Når mengden aminosyrer som forbrukes øker blir derfor nitrogenoverskuddet tilsvarende større. Overskudd av aminogrupper kan ende opp som NH3, som er toksisk. Overskudd av nitrogen må derfor omdannes til en ikke toksisk metabolitt - urea. Følgelig øker ureasyntesen når forbruket av aminosyrenes karbonskjeletter øker.

28

Hvilken rolle spiller enzymene aminostransferaser og glutamat dehydrogenase hva angår eliminering av kroppens nitrogenoverskudd? Beskriv og forklar.

De to enzymene har til sammen en sentral funksjon hva angår å sørge for at overskudd av nitrogen fra katabolismen av aminosyrer blir anvendt i syntesen av urea. Dette illustreres ved å se på summen av de to reaksjonene:

Alanin + a ketoglutarat -> pyrovat + glutamat
Glutamat + NAD+ + H2O -> a ketoglutarat + NADH + NH4+

Aminosyrenes aminogruppe blir ved hjelp av disse to reaksjonene frigjort som NH4+. Siden glutamat DH bare finnes i mitokondrienes matriks blir NH4 + nå bare dannet i mitokondriematriks. Her finnes også karbamoylfosfat syntetase, som er den innledende reaksjonen i urea syklus. Følgelig sørger disse to reaksjonene for at NH4+ bare frigjøres hvor NH4+ raskt kan bli detoksifisert. De to reaksjonene blir derfor et metabolsk verktøy som sørger for at overskudd av aminogrupper trygt føres inn i ureasyntesen.

29

Forklar hvordan folat påvirker purinsyntesen.

Folat er et vitamin. Tetrahydrofolat er en bærer av en-karbon-fragmenter. Disse karbonfragmentene får tetrahydrofolat fra aminosyrer og inkorporerer de i purinringen i forbindelse med syntese av purinnukleotider. Lave nivåer av folat vil redusere syntesen av purinnukleotider.