Week Three Flashcards by Alexia Silva

Cleavage furrow forms around the center of cell, progresses inward, and separates cytoplasm into two separate and usually equal portions.

Cytokinesis

How well did you know this?

Not at all

Perfectly

Sister chromatids separate and chromosomes move to opposite poles of cell

Anaphase

How well did you know this?

Not at all

Perfectly

Chromatin shortens and coils into chromosomes, nucleoli and nuclear envelope disappear, a centrosome and its centrioles move to opposite poles, and mitotic spindles from

Prophase

How well did you know this?

Not at all

Perfectly

Chromosomes (each consisting of sister chromatids) line up on the equatorial plate which is at the center of the cell

Metaphase

How well did you know this?

Not at all

Perfectly

Nuclear envelope reappears and encloses chromosomes, chromosomes resume chromatin form, nucleoli reappear, and mitotic spindle disappears.

Telophase

How well did you know this?

Not at all

Perfectly

Site of protein synthesis and brief storage of proteins. Has ribosomes attached.

RER (Rough Endoplasmic Reticulum)

How well did you know this?

Not at all

Perfectly

Site of synthesis of fatty acids, phospholipids, and steroids

SER (Smooth Endoplasmic Reticulum)

How well did you know this?

Not at all

Perfectly

Site of enzyme production that detoxify alcohol and other harmful chemicals

SER (Smooth Endoplasmic Reticulum)

How well did you know this?

Not at all

Perfectly

Stacks of cisterns (membranes) with vesicular ends, involved in packaging and secretion of proteins. The products are packaged into vesicles for distribution within the cell or for secretion. Known as the shipping center of the cell.

Golgi Complex

How well did you know this?

Not at all

Perfectly

Vesicles containing hydrolytic enzymes used to digest food, old organelles, and destruction of foreign particles (bacteria, viruses, and toxins)

Lysosomes

How well did you know this?

Not at all

Perfectly

Cristae-containing structures, called “powerhouses of the cell” because ATP production occurs here.

Mitochondria

How well did you know this?

Not at all

Perfectly

Part of cytoskeleton, provide support and give shape to cell; form flagella, cilia, and spindle fibers.

Microtubules

How well did you know this?

Not at all

Perfectly

Help organize mitotic spindle used in cell division

Centrioles

How well did you know this?

Not at all

Perfectly

Long, hairlike structures that help move entire cell, as in sperm cells

Flagella

How well did you know this?

Not at all

Perfectly

Short, hairlike structures that move particles over cell surfaces

Cilia

How well did you know this?

Not at all

Perfectly

Are fingerlike projections that are part of the outer (apical) membrane surface - function to increase surface area of the cell membrane

Microvilli

How well did you know this?

Not at all

Perfectly

Abundant in liver cells that detoxify Phenobarbital and other drugs that enter the liver

SER (Smooth Endoplasmic Reticulum)

How well did you know this?

Not at all

Perfectly

if RBCs are surrounded by a hypertonic solution, water will tend to move ________ the cells, could cause them to ________.

out of; crenate

How well did you know this?

Not at all

Perfectly

Nucleoli are organelles that:

synthesize the components of ribosomes

How well did you know this?

Not at all

Perfectly

Term that means tumor or abnormal growth

Neoplasm

How well did you know this?

Not at all

Perfectly

A cancerous tumor is a ___________ (benign or malignant) neoplasm?

Malignant

How well did you know this?

Not at all

Perfectly

A noncancerous tumor is a ___________ (benign or malignant) neoplasm?

Benign

How well did you know this?

Not at all

Perfectly

Which type of growth is more likely to spread and possible cause death? Benign or Malignant.

Malignant

How well did you know this?

Not at all

Perfectly

Term that means the spread of cancer cells is

Metastasis

How well did you know this?

Not at all

Perfectly

Tay-Sachs disease is a rare, inherited disease that causes rapid aging

False

Ribosomes are involved in protein synthesis

True

Pinocytosis is considered a passive transport process

False

The movement of mucus in the respiratory passageways is a function of the flagella

False

Nuclear pores in the nuclear membrane or envelope allow most ions, mRNA, and water-soluble molecules to shuttle between the nucleus and the cytoplasm

True

Interstitial fluid and intercellular fluid are two different fluids

False

Mitosis produces two daughter cells identical to the parent cells

True

Meiosis is the mechanism by which eggs and sperm cells are produced

True

Which of the following is the correct sequence of the cell cycle beginning with the cell in its normal functioning state (not dividing) and then entering interphase in order to divide:

Go, G1, S, G2, mitosis

The four stages of mitosis in correct sequence are:

prophase, metaphase, anaphase, telophase

If a cell undergoing mitosis normally has 46 chromosomes, how many chromosomes will each of the daughter cells have?

The normal functional state of a cell not dividing

Go Phase

Cell prepares for replication. Cell produces all the enzymes required for DNA replication and duplicates most of its organelles

G1 Phase

Chromosomes are replicated and become double stranded. The replicated chromosomes are attached together at the centromere and are known as sister chromatids. Each is an exact copy of the other and is called a chromatid.

S Phase

Devoted to last minute protein synthesis as cell prepares to divide.

G2 phase

Active transport is a process by which substances are transported across a plasma membrane from an area of their ________ concentration to an area of their ______ concentration.

Low:high

DNA molecules contain information for building specific [ Select ] .

proteins

In a three-dimensional view, a DNA molecule looks like a spiral staircase; this is correctly called a [ Select ] .

double helix

The constant parts of DNA molecules are the [ Select ] and [ Select ] molecules, forming the DNA-ladder uprights, or backbones.

sugar: phosphate

The information of DNA is actually coded in the sequence of nitrogenous-containing [ Select ] , which are bond together to form the "rungs" of the DNA ladder.

bases

The N-containing bases are [ Select ] , which means that only certain bases can fit or interact together.

complementary

Specifically, this means that [ Select ] can bind with guanine, and adenine binds with [ Select ] .

cytosine: thymine

Chromatin condenses to form visible (with a microscope) chromosomes

Prophase

Centrioles produce spindle fibers (microtubules), which extend and attach to the centromeres of each chromosome

Prophase

Nucleolus and the nuclear membrane disappear

Prophase

Sister chromatids separate at the centromere forming two sets of identical chromosomes.

Anaphase

A nuclear membrane forms around each set of chromosomes, chromosomes uncoil becoming chromatin, nucleoli reappear, cell prepares to divide

Telophase

The cell membrane constricts along the plane of the center plate forming a cleavage furrow. Cytoplasm divides resulting in two daughter cells each with DNA that is identical to the DNA of the parent cell

Cytokinesis

Chromosomal material replicates

S phase

Process produces two daughter cells identical to the parent cell

mitosis

Process by which eggs and sperm are produced

meiosis

Net movement of any substance from a region of higher concentration to a region of lower concentration through a selectively permeable membrane

Simple diffusion

Net movement of any substance from a region of higher concentration to a region of lower concentration but requires a protein transporter in a selectively permeable membrane. ATP not required

Faciliated diffusion

Net movement of water from a region of higher water concentration to a region of lower water concentration through a selectively permeable membrane

Osmosis

Means "cell drinking"

Pinocytosis

Process of cellular ingestion of large substances by endocytosis

Phagocytosis

Process of cellula secretion of nueortransmitter from neurons and hormones from endocrine cells

Exocytosis

AACTTACGCCATAGCGATTC What would the corresponding DNA sequence be?

TTGAATGCGGTATCGCTAAG

AACTTACGCCATAGCGATTC What would the corresponding RNA sequence be?

UUGAAUGCGGUAUCGCUAAG

AACTTACGCCATAGCGATTC What is the amino acid sequence coded for by this DNA sequence

Met - Arg - Tyr - Arg

AACTTACGCCATAGCGATTC What is the start codon for RNA

AUG

During the process of translation what is produced

protein

During the process of transcription what is produced

mRNA

How many individual chromosomes are found in each human somatic cell

46 or 23 pairs

At the end of the electron transport chain, oxygen accepts the electrons and becomes

water

Antibiotics such as streptomycin and tetracycline kill bacteria by interfering with the function of what specific organelle

ribosomes

A cell was placed into a solution and began to swell then burst. The solution was

hypotonic

In the video on RNAi, what cartoon characters were used to represent the ribosomes

Chefs

What nucleotide is not found in DNA

uracil

The functions of the Golgi apparatus include:

synthesis, storage, alteration, packaging

In a hospital, a nurse gave a patient recovering from surgery a transfusion of 5% salt solution by mistake instead of a transfusion of physiological saline (0.9% salt). The patient quickly went into shock and soon after died. What caused the patient to enter into a state of shock and die?

Because of the increase of solute concentration in the body fluid, it became hypertonic to the RBCs. The RBCs dehydrated and shrank – crenation. The crenated RBCs lost their oxygen-carrying capacity and the body tissues were deprived of the oxygen necessary of cellular metabolism to support life.

You over hear a group of teenagers betting each other as to who could drink the most water within a 30 minute time span. Being the excellent human biology student that you are you interrupt them and explain the dangers of drinking seemingly harmless liquid (water) in such a short period of time. What is your explanation?

Drinking water is hypotonic to the cells of you body. Taking in too much water in a short period of time will cause the blood and eventually the interstitial fluid to become hypotonic to the body cells. The extracellular water will then move by osmosis into the body cells and could cause them to swell and possibly rupture. This could, and has in the past, kill a person.

The fluid inside cells

intracellular fluid

The fluid in the spaces between cells

interstitial or intercellular fluid or extracelluar fluid

Blood and lymph are known as what type of fluid

extracelluar fluid

The organelle that carries out the process of autophagy in which old organelles are digested so that their components can be recycled is:

lysosome

The process that describes the net movement of molecules or ions from a region of their higher concentration to a region of their lower concentration across a plasma membrane.

simple diffusion

The process involving the movement of solvents, such as water, and dissolved substances across a selectively permeable membrane by gravity or mechanical pressure. Substances pass through the membrane based on their size.

filtration

This passive process is accomplished with the assistance of integral proteins in the membrane that serve as carriers to substances as they move from an area of higher concentration to an area of lower concentration

faciliated diffusion

The process in which there is a net movement of water molecules through a selectively permeable membrane from an area of high water concentration to an area of low water concentration.

osmosis

If a cell undergoing meiosis normally has 46 chromosomes, how many chromosomes will each of the daughter cells have?

How many amino acids are common to all organisms

Each sequence of three nucleotides (triplet) is called a _______ and specifies a particular amino acid or termination signal

codon

The transfer of genetic instruction from a gene to a strand of messenger RNA (mRNA).

transcription

Process of converting the information contained in messenger RNA into a specific sequence of amino acids to produce a protein

translation

What type of nucleotide is not found in messenger RNA?

thymine

tRNA's transfer what specific molecules?

amino acids

These organelles function as the site of protein synthesis in the cytoplasm and are made up of a large and small unit.

ribosomes

The production of proteins involves the cooperation of DNA and RNA. RNA is another type of nucleic acid that serves as a messenger to DNA. That is, it leaves the nucleus and carries out the instructions of the DNA for the building of a protein on a cytoplasmic structure called a

ribosome

When a cell is preparing to divide, in order for its daughter cells to have all its information, it must oversee the — of its DNA so that a "double dose" of genes is present for a brief period. For DNA synthesis to occur, the DNA must uncoil, and the bonds between the nitrogenous bases must be broken.

replication

Then the two single strands of —— each act as a —— for the building of a whole DNA molecule.

nucleotides: template

When completed, each DNA molecule formed is half new and half old. The fact that DNA replicates before a cell divides ensures that each daughter cell has a complete set of .

genes

Cell division, which then follows, provides new additional cells so that —- and repair can occur.

growth

In somatic cell division the division of the —- is referred to as mitosis.

nucleus

—- is the division of the cell or cytoplasm.

cytokinesis

The major structural difference between chromatin and chromosomes is that chromosomes are tightly

coiled

Chromosomes attach to the spindle fibers by structures called

centromeres

More specifically, each centromere as a —- that the spindle fiber attaches to.

kinetochore

Week Three Flashcards

(102 cards)