8.4: Gene technologies

Question 1

What is recombinant DNA technology

Answer 1

a form of genetic engineering which results in genetically modified organisms (GMO)
It is the combining of different organisms’ DNA

Question 2

State 2 reasons why recombinant DNA technology is useful

Answer 2

1- improve crops
2- medical benefits

Question 3

How is recombinant DNA technology used to improve crops

Answer 3

make them drought / pesticide resistant

Question 4

How is recombinant DNA technology used for medical benefits

Answer 4

1- gene therapy - replace the allele that produces a non-functional protein with an allele that produces a functional protein
2- production of human proteins - use of bacteria to produce human insulin

Question 5

What are the 6 stages involved in recombinant DNA technology

Answer 5

1- Identify and isolate the target gene (e.g. human insulin gene)
2- Amplify the gene using PCR
3- Insert the gene into a vector (plasmid/virus/liposome)
4- Transfer the vector into the host cells/organism
5- Identify the genetically modified cells/organisms
6- Amplify the genetically modified cells/organisms

Question 6

What are the 3 methods that can be used to identify and isolate the target gene, in recombinant DNA technology

Answer 6

1- Work backwards from the polypeptide
2- Work backwards from mRNA
3- The gene machine

Question 7

Explain the process of identifying and isolating the target gene in recombinant DNA technology, by working backwards from the polypeptide

Answer 7

Find the amino acid sequence of the target gene, work out the base sequence for the mRNA, use this to create a gene probe, heat the DNA to 95 ºC (break the H-bonds, DNA becomes single stranded), add gene probe and cool - gene probe attaches to the target gene, enzymes called Restriction endonucleases hydrolyse the phosphodiester bonds and cut the DNA at specific base sequences (recognition sites), this produces sticky ends.

Question 8

What are ‘sticky ends’

Answer 8

short section of exposed DNA nucleotides, can form H-bonds with complementary sticky ends/nucleotides

Question 9

How do restriction endonucleases hydrolyse the phosphodiester bonds and cut the DNA

Answer 9

in a staggered manner, e.g.
GAATTC/CTTAAG becomes
_AATTC/_____G

Question 10

What is the region at the start of the target gene DNA sequence called where restriction endonucleases cut

Answer 10

promoter region

Question 11

What is the region at the end of the target gene DNA sequence called where restriction endonucleases cut

Answer 11

Terminator sequence

Question 12

Explain the process of identifying and isolating the target gene in recombinant DNA technology, by working backwards from mRNA

Answer 12

mature mRNA is isolated from cytoplasm of cells. Reverse transcriptase joins DNA nucleotides with complementary bases to the mRNA to form cDNA (single stranded ‘copy’ DNA). DNA polymerase and DNA nucleotides are used to make this DNA fragment double stranded. Produces target gene without introns (sticky ends added) - no promoter region, no terminator sequence, as mature mRNA contains no introns.

Question 13

Why do sticky ends need to be added to double stranded cDNA, in recombinant DNA technology (when identifying and isolating the target gene)

Answer 13

Sticky ends are necessary for when the gene is inserted into a plasmid

Question 14

What is the full form of PCR

Answer 14

Polymerase Chain Reaction

Question 15

What does amplify mean in relation to genes

Answer 15

artificial DNA replication, to produce multiple copies of the gene

Question 16

What is the difference between ‘in vitro’ and ‘in vivo’

Answer 16

‘in vitro’ = ‘in glass’
‘in vivo’ = ‘in organism’

Question 17

What does PCR require

Answer 17

DNA polymerase - Taq polymerase
DNA nucleotides
Target gene - acts as a template
DNA primers

Question 18

What is Taq polymerase

Answer 18

thermostable enzyme - does not denature even in very high temperatures

Question 19

What are DNA primers

Answer 19

short lengths of single stranded DNA that attach to template strands to form double stranded DNA, allowing DNA polymerase to attach

Question 20

Explain fully the process of PCR

Answer 20

1- add the DNA fragment to be replicated (target gene) and heat to 95ºC to break H-bonds and split the DNA into single strands
2- Cool to 50ºC and add DNA primers which anneal to the single strands of DNA
3- Add DNA nucleotides and Taq Polymerase and heat to 72ºC (optimum temp. for Taq polymerase), Taq polymerase attaches complementary free DNA nucleotides to form a new strand next to each template strand.
Replication continues until primers or nucleotides runo ut

Question 21

State 3 benefits of using PCR to amplify genes and a disadvantage

Answer 21

benefits: automated, rapid, doesn’t require living cells
disadvantages: replication is not checked for errors and so mutations will be replicated, results in a percentage of the molecules that may not produce the functional protein

Question 22

Explain fully how the target gene is inserted into a plasmid (vector) in recombinant DNA technology

Answer 22

Plasmid is cut open with the same restriction endonuclease that was used to isolate that target gene, so this produces complementary sticky ends to the target DNA fragment. Hydrogen bonds form between complementary sticky ends (plasmid and target gene). The enzyme DNA ligase catalyses the formation of a phosphodiester bond between the target gene and the plasmid - anneals the DNA. This produces a recombinant plasmid.

Question 23

What does ‘anneal’ mean

Answer 23

recombine DNA

Question 24

Explain fully how the recombinant plasmid is inserted into a bacterium in recombinant DNA technology

Answer 24

Bacteria go through ‘thermal shock’ - this is a sudden increase then decrease in temperature, and makes the cell membrane more permeable, enabling the recombinant plasmid to enter the bacteria. Producing genetically modified bacteria (GM bacteria)

Question 25

When the recombinant plasmid is inserted into a bacterium in recombinant DNA technology, what three types of bacteria will be produced

Answer 25

1- bacteria with no plasmids 2- bacteria with normal plasmids because the plasmid rejoined (complementary sticky ends) before the DNA fragment entered 3- bacteria with recombinant plasmids

Question 26

What is used to identify the genetically modified bacteria in recombinant DNA technology, and what must the plasmids used earlier contain

Answer 26

uses antibiotic resistance genes and antibiotics to identify GM bacteria the plasmids used must contain two antibiotic resistance genes (tetracycline resistance gene and ampicillin resistance gene)

Question 27

What is the difference (in terms of antibiotic resistance) between a normal plasmid and a recombinant plasmid

Answer 27

a normal plasmid contains tetracycline and ampicillin resistance genes, whereas in a recombinant plasmid, the target gene is inserted in the tetracycline resistance gene, disrupting that gene and so tetracycline resistance gene cannot be expressed

Question 28

Explain fully the process of identifying the genetically modified bacteria in recombinant DNA technology

Answer 28

The bacteria are grown on agar plates to form colonies, involves replica plating: The master plate contains no antibiotics, and all the bacteria form colonies. Bacteria from here is then transferred to the ampicillin plate, which contains ampicillin, and so only bacteria with plasmids form colonies. Bacteria from here is then transferred to the tetracycline plate, which contains tetracycline, and so only bacteria with NORMAL plasmids will form colonies as genetically modified bacteria cannot. The bacteria that form colonies in the ampicillin plate but not in the tetracycline plate are the GM bacteria

Question 29

Explain how the genetically modified bacteria are grown, in recombinant DNA technology

Answer 29

Transfer the GM bacteria to a growth medium and allow them to multiply, reproduce asexually via binary fission, all offspring are genetically identical and so they all contain the target gene. This replication is a form of 'in vivo'

Question 30

What does DNA profiling/genetic fingerprinting involve

Answer 30

involves introns, as they contain Variable Number Tandem Repeats (VNTRs)

Question 31

What are Variable Number Tandem Repeats (VNTRs)

Answer 31

tandem repeat - short sequence of repeating DNA variable number - may occur any number of times e.g. GATAGATAGATAGATAGATAGATA

Question 32

What are the five steps of creating a DNA profile

Answer 32

1- Extract a DNA sequence 2- Amplify the DNA, using PCR 3- Digest the DNA using restriction endonucleases 4- Separate out the fragments, using gel electrophoresis 5- Locate the fragments (containing the VNTR)

Question 33

How can a DNA sequence be extracted for creating a DNA profile

Answer 33

blood sample, hair sample, etc

Question 34

Explain how the DNA is digested using restriction endonucleases when creating a DNA profile

Answer 34

restriction endonucleases cut the DNA at specific recognition sequences. These sequences occur at random along the length of the DNA molecule and so produces a mixture of DNA fragments of different lengths with sticky ends

Question 35

Fully explain how the DNA fragments are separated using gel electrophoresis, when creating a DNA profile

Answer 35

The DNA samples/fragments are loaded into small wells in agar gel, the gel is placed in a saline solution with an electrical voltage (direct current) applied, the DNA fragments move through the gel towards the positive electrode (as DNA is negatively charged due to phosphate group), shorter fragments move faster through the gel and so move further through the gel

Question 36

Why is gel electrophoresis called gel electrophoresis

Answer 36

gel - agarose gel electrophoresis - a direct electrical current is applied to the gel

Question 37

Fully explain how DNA fragments containing the VNTR are located, when creating a DNA profile

Answer 37

1- alkaline solution is placed on the gel, this breaks the H-bonds, the double stranded DNA fragments become single stranded DNA fragments. 2- a nylon mesh is placed on the gel, single stranded DNA fragments attach and are fixed in position 3- DNA probes are added which is a short length of single stranded DNA with a complementary base sequence to the VNTR and is radioactively labelled. If the VNTR is present, the probe will attach by complementary base pairing. 4- Photographic film is place in the gel, the radioactive probe causes the film to fog, revealing the position of the VNTR

Question 38

Give 5 applications of DNA profiling

Answer 38

1- criminal investigations 2- conservation/captive breeding 3- phylogenetics/taxonomy 4- Medical diagnosis of genetic conditions 5- Gene sequencing

Question 39

Describe how DNA profiling can be used for medical diagnosis of genetic conditions

Answer 39

determine the base sequence of the mutated allele (e.g. early onset alzheimer's) and create a gene probe with the complementary base sequence

Question 40

Give two applications of genomics

Answer 40

1- phylogenetics 2- identifying mutated gene variants that lead to genetic conditions - helps in development of targeted drugs/treatments

Question 41

Explain what gene therapy is and how it works

Answer 41

gene therapy is treatment for conditions caused by genetics. Involves the replacement/supplementation of a mutated gene which produces a non functional protein, with a normal gene which produces the functional protein. The normal gene is inserted into a vector (liposome, virus - genes responsible for replication are removed), and the vector is delivered to the patient via an inhaler

Question 42

What are 2 types of gene therapy

Answer 42

Somatic cell therapy Germ line therapy

Question 43

Describe what Germ line therapy is and how it works in gene therapy

Answer 43

Replacing the gene within the gametes. IVF to create a zygote with the normal gene, and so all somatic cells will contain the normal gene and produce the functional protein