lecture quiz 4 Flashcards
(11 cards)
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with four stars
5’ATCGGGCTACCCATGAAATGCTAGCTT**TAGATCTTAAGCTAGCTAGTTCGATCTGA3’
What is the sequence of the primers for the LEADING strands?
5’-AAGCUAGC-3’
5’-UAGAUCUU-3’
The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with four stars
5’ATCGGGCTACCCATGAAATGCTAGCTT**TAGATCTTAAGCTAGCTAGTTCGATCTGA3’
What is the sequence of the LEADING strand for the sequence that is underlined?
5’-CTAGCTAGTT-3’
The following DNA is being replicated and the origin of replication is to the left of the sequence and marked with four stars
5’**ATCGGGCTACCCATGAAATGCTATGCTTTAGATCTTAAGCTAGCTAGTTCGATCTGA3’
For the region that is underlined what is the sequence of the TEMPLATE for the LEADING strand?
5’-AGCATAGCA-3’
A man who is an achondroplastic dwarf with normal vision marries a colour-blind woman of normal height. The man’s father was 6 feet tall, and both the woman’s parents were of average height. Achondroplastic dwarfism is autosomal dominant, and red-green colour blindness is X-linked recessive.
How many of their daughters might be expected to be colour-blind dwarfs?
none
Tallness (T) in snapdragons is dominant to dwarfness (t), while red (R) flower colour is dominant to white (r). The heterozygous condition results in pink (Rr) flower colour.
A dwarf, red snapdragon is crossed with a plant homozygous for tallness and white flowers. What are the genotype and phenotype of the F1 individuals?
TtRr—tall and pink
A homozygous tomato plant with red fruit and yellow flowers was crossed with a homozygous tomato plant with golden fruit and white flowers. The F1 all had red fruit and yellow flowers. The F1 were testcrossed by crossing them to homozygous recessive individuals and the following offspring were obtained:
Red fruit and yellow flowers—41 Red fruit and white flowers—7 Golden fruit and yellow flowers—8 Golden fruit and white flowers—44
How many map units separate these genes?
15
Glucose-6-phosphate dehydrogenase deficiency (G6PD) is inherited as a recessive allele of an X-linked gene in humans. A woman whose father suffered from G6PD marries a normal man.
(a) What proportion of their sons is expected to be G6PD?
(b) If the husband was not normal but was G6PD deficient, would you change your answer in part (a)?
(a) 1/2; (b) no
A man who carries an allele of an X-linked gene will pass it on to whom?
all of his daughters
Which of the following describes the ability of a single gene to have multiple phenotypic effects?
pleiotropy
The fact that all seven of the pea plant traits studied by Mendel obeyed the principle of independent assortment most probably indicates which of the following?
- All of the genes controlling the traits behaved as if they were on different chromosomes.
- All of the genes controlling the traits were located on the same chromosome.
- None of the traits obeyed the law of segregation.
- The formation of gametes in plants occurs by mitosis only.
- The diploid number of chromosomes in the pea plants was 7.
All of the genes controlling the traits behaved as if they were on different chromosomes.
What is the sequence of the primer that would bind to the underlined region of the following DNA during replication?
5’AGTCCTAGTACGTAGCTTGACTAGCTATTACCGTATCTGTCACGCG3’
5’-UGACAGAUACG-3’