lecture quiz 5 Flashcards
(15 cards)
For the human CYBA gene, which of the following contributes to the differences in the proteins that are created from Splice variant #1 and Splice variant #2?
- Different transcriptional stop location
- Different translational start location
- Alternative 5’ or 3’ splice site
- Different transcriptional start location
- Inclusion of an additional exon(s)
- Different length of the pre-mRNA
- Different translational stop location
- Alternative 5’ or 3’ splice site
- Different translational stop location
For the human SMNDC1 gene, which of the following contributes to the differences in the mature mRNAs created from Splice variant #1 and Splice variant #2?
- Different transcriptional start location
- Inclusion of an additional exon(s)
- Different transcriptional stop location
- Different translational stop location
- Different length of the pre-mRNA
- Different translational start location
- Alternative 5’ or 3’ splice site
- Inclusion of an additional exon(s)
- Different length of the pre-mRNA
- Different translational start location
Using NCBI, look at the alternatively spliced transcripts for human PPIF. The coding region for splice variant #1 is longer than splice variant #2.
True/False
False
Using NCBI, look at the alternatively spliced transcripts for human CYBA. The coding region for splice variant #1 is longer than splice variant #2.
True/False
False
Using NCBI, look at the alternatively spliced transcripts for human SMNDC1.
What nucleotides of the pre-mRNA would be the same for splice variant #1 and splice variant #2 ?
Insert the nucleotides from the start to the end of the shared region.
50-11930
Using NCBI, look at the alternatively spliced transcripts for human SMNDC1
What nucleotides of the pre-mRNA would be the same for splice variant #1 and splice variant #2 ?
Insert the nucleotides from the start to the end of the shared region.
1350-14191
Which polymerases add nucleotides to an existing nucleic acid strand?
- Telomerase
- Primase
- Topoisomerase
- DNA polymerase
- Poly A polymerase
- RNA polymerase
- DNA polymerase
- Poly A polymerase
- Telomerase
Which polymerases synthesize RNA?
- Primase
- DNA polymerase
- Poly A polymerase
- RNA polymerase
- Topoisomerase
- Telomerase
- Primase
- RNA polymerase
Below is the DNA sequence of a gene, what is the protein sequence?
5’GGTAA*TGCTAGCTCCCCCTGACATCGATATCTGACTAGCTG-3’
If a nucleotide was inserted into this sequence at the * what would be the impact on the protein?
there would be no protein
Below is the DNA sequence of a gene, what is the protein sequence?
5’GGTAATGCTAGCTCCCCCTGACATCGATATC*TGACATAGCTG-3’
If a nucleotide was inserted into this sequence at the * what would be the impact on the protein?
The protein would be longer
Below is the DNA sequence of a gene, what is the protein sequence?
5’-GCCTAGTAGATGAAACTACTCGCTTGACCTAGCCCTGACATCGATATCGACTAGCTG-3’
Insert the amino acid sequence using the single letter designation for the amino acid
MKLLA
Using NCBI, look at the alternatively spliced transcripts for human CTRB1. Translation terminates at the same nucleotide for both splice variant #1 and splice variant #2.
true/false
False
Using NCBI, look at the alternatively spliced transcripts for human PPIF. Transcription terminates at the same nucleotide for both splice variant #1 and splice variant #2.
true/false
True
Using NCBI, look at the alternatively spliced transcripts for human ADH1B. Transcription starts at the same nucleotide for both splice variant #1 and splice variant #2.
true/false
True
Using NCBI, look at the alternatively spliced transcripts for human CYBA. Translation terminates at the same nucleotide for both splice variant #1 and splice variant #2.
true/false
false