Exercices 7.1 Flashcards Preview

Biologie moléculaire > Exercices 7.1 > Flashcards

Flashcards in Exercices 7.1 Deck (16):
1

Quelle est la masse molaire d'un nucléoside monophosphate?

330g/mole

2

Quelle est la distance entre les nucléotides d'une chaîne?

0,34nm = 0,35 x 10^9

3

Taille de la bactérie E. Coli

1um

4

Combien de molécules d'ADN contient une mole?

6,02 x 10^23

5

Les enzymes de restriction coupent une séquence spécifique de l'ADN. Vrai/Faux

Vrai

6

Deux enzymes de restriction différentes ne peuvent jamais couper la même séquence. Vrai/Faux

Vrai

7

Enzymes de restriction sont d’origine virale. Vrai/Faux

Faux

8

Enzymes de restriction appartiennent à la famille des nucléasesVrai/Faux

Vrai

9

3' TGACCCAGCC 5'
3' GGCTGGGTCA 5'
Ce fragment d’ADN est digéré par l’enzyme de restriction PvuII (CAG/CTG) et PstI
(CTGCA/G). Quel est le nombre et la taille des fragments obtenus ?

5 fragments

10

3' TGACCCAGCC 5'
3' GGCTGGGTCA 5'
Vrai/Faux : On souhaite amplifier l’intégralité de cette séquence par PCR.
A. Cette technique permet de répliquer in vitro la matrice d’ADN
B. Après 35 cycles d’amplification, la matrice d’ADN est amplifiée environ 1000 fois
C. Cette technique utilise des cycles successifs
D. Cette technique permet d’amplifier un fragment d’ADN ayant une longueur de
100 000 pb.
E. Cette technique est réalisable avec n’importe quelle ADN polymérase

Vrai :
A et B

11

3' TGACCCAGCC 5'
3' GGCTGGGTCA 5'
Quelle amorce sens faut-il choisir pour amplifier ce fragment ?
A. ATGGCCTCTTCTGATGCAGC
B.TGACCCAGCCGCAGGCATGGTGAA
C. GGCCTCTTCTGATGCAGC
D. TGACCCAG

B et C

12

7. Parmi les enzymes suivantes, laquelle (lesquelles) a (ont) besoin d’une amorce pour initier
leur action enzymatique ?
A. L’ARN polymérase II
B. La transcriptase inverse
C. La Taq polymérase
D. La Taq polymérase kinase
E. L’ADN polymérase I

B, D et E

13

Choisir parmi les sondes
proposées celles qui peuvent s’hybrider avec la région
GTGGGGCAGG TGGAGCTGGG
CGGGGGCCCT GGTGCAGGCA
A. GTGGGGCAGGTGGAGCTCGG
B. TGGAGCTGGGCGGGGGCCCT
C. CCCAGCTCCACCTGCCCCAC
D. AGGGCCCCCGCCCAGCTCCA
E. CGGGGGCCCTGGTGCAGGCA

Toutes!

14

choisir parmi les différentes
propositions celles qui pourraient permettre l’insertion de la région 1 dans le multiple site de
clonage du vecteur pCMV-Script.
A. Digestion de l’amplicon et du vecteur pCMV-Script par PstI puis ligation à l’aide d’une
ADN ligase.
3
B. Digestion de l’amplicon et du vecteur pCMV-Script par PstI et PvuII puis ligation à
l’aide d’une ADN ligase.
C. Digestion de l’amplicon par PstI et PvuII et digestion du vecteur pCMV-Script par PstI
puis ligation à l’aide d’une ADN ligase.
D. Digestion de l’amplicon et du vecteur pCMV-Script par AluI (AG/TC) puis ligation à
l’aide d’une ADN ligase.
E. Digestion de l’amplicon par PstI et digestion du vecteur pCMV-Script par AluI puis
ligation à l’aide d’une ADN ligase.
Une autre expérience a permis d’insérer l’intégralité de la séquence de 300 pb dans le vecteur
pCMV-Script. Le vecteur utilisé étant un vecteur d’expression eucaryote, ce fragment peut être
transcrit et traduit.
En admettant que le brin d’ADN servant de matrice pour la transcription de ce fragment le brin
complémentaire de celui indiqué à figure 1, répondre aux questions 10 et 11.

A, B et C. En gros digestion de l'amplicon et du vecteur doivent être par la même enzyme et
- Alul (AG/TC) n'est pas un bon enzyme

15

Pour TGACCCAGCC, quelles sont les 10 premières bases de l'ARN?

UGACCCAGCC

16

12. Parmi les propositions suivantes, laquelle correspond aux 10 premières bases de l’ARN ?
A. UGACCCAGCC
B. GCAGCCCCCC
C. GGCUGGGUCA
D. GGGGGGCUGC
E. CCGACCCAGU

On part de la fin du brin matrice!!!!!