bio chap 13

Question 1

False statements about sequence motifs

Answer 1

Sequence motifs are only found in DNA―they do not occur in RNA.
When sequence motifs occur in DNA, they are only found upstream of protein-coding regions.
All sequence motifs would also be considered open reading frames, but not all open reading frames would be considered sequence motifs.
Sequence motifs in RNA do not provide any information on possible sequence motifs in DNA.

Question 2

The human chromosome 1 is approximately 250 million nucleotides long. In order to sequence human chromosome 1, the chromosome is digested into hundreds of small fragments. These short fragments are placed together in the correct order to generate the long, continuous sequence of nucleotides in chromosome 1. Placing these fragments together is referred to as:

Answer 2

sequence assembly.

Question 3

The C-value paradox is the:

Answer 3

disconnect between genome size and organismal complexity.

Question 4

In the eukaryotic DNA sequence below, which type of repeat is highlighted?
ATTATTTACTAATCCTCATCATCATCATCATGGAATTCATAATGCTAATGG

Answer 4

tandem repeat

Question 5

What was the goal of the Human Genome Project?

Answer 5

sequencing every gene in the human cell

Question 6

The region of DNA sequences before the start of a gene is often called the promoter. One type of promoter is called the TATA box. Many species’ promoters are TATA boxes or a variation of the TATA box. DNA sequences that are similar in different organisms are called _______________ sequences.

Answer 6

conserved

Question 7

Transposable elements are:

Answer 7

DNA sequences that can insert themselves into new positions within the genome

Question 8

DNA transposable elements (DNA TEs) are:

Answer 8

a class of transposable elements that replicate and transpose via DNA replication and repair.

Question 9

Whenever a genome is annotated, researchers identify all of the protein-coding genes and assign each protein with a function.

Answer 9

false

Question 10

Only 2.5% of the human genome actually codes for proteins. The other 97.5% includes:

Answer 10

noncoding RNA.
repetitive DNA.
introns.

Question 11

Having more than two sets of chromosomes in the genome called:

Answer 11

polyploidy

Question 12

All of the following are ways we account for the disconnect between levels of complexity and gene number between organisms EXCEPT:

Answer 12

All of the answer options are reasons for the disconnect between complex and less complex organisms.
different gene products are made in different amounts.
proteins are capable of combining in many different ways to perform different functions.
a single gene may yield different proteins due to alternative splicing.

Question 13

Imagine that a researcher is comparing the sequence of several protein-coding genes between mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences. What can she deduce?

Answer 13

More sequences are conserved between rabbits and humans than between humans and mice.

Question 14

long terminal repeats (LTRs) are:

Answer 14

a class of transposable elements that uses RNA as an intermediate.

Question 15

Repeated sequences within eukaryotic genomes may be represented as long repeated sequences next to each other, and are called ___________ repeats. Repeated sequences in eukaryotic genomes can also be located throughout the genome, and are called _______________ repeats.

Answer 15

tandem; dispersed

Question 16

Repeated sequences make DNA sequencing challenging for of all of the following reasons EXCEPT:

Answer 16

the long repeats often have mutations that are not easily sequenced.

Question 17

Whole genome sequencing is often approached by a shotgun sequencing approach in which:

Answer 17

large genomes are randomly digested, short fragments are sequenced, and the overlapping sequences are assembled in order.

Question 18

Which of the following is not a type of sequence identified by gene annotation?

Answer 18

topoisomerase

Question 19

Which of the following statements is true regarding a genome?

Answer 19

Genomes are “heritable,” or passed from parents to offspring.

Question 20

Which of the following are sequence motifs?

Answer 20

hairpin structures
open reading frame
transcription factors
coding region

Question 21

The human genome is different for every individual.

Answer 21

true

Question 22

Knowing an individual’s DNA sequence may be beneficial because:

Answer 22

it makes it possible to predict susceptibility to disease.
it makes it possible to predict response to medications.
it makes it possible to predict physical differences.
it makes it possible to predict the occurrence of a disease.

Question 23

Sequence assembly is accomplished by

Answer 23

aligning the fragments by using a complex computer program.

Question 24

In the eukaryotic DNA sequence below, which type of repeat is highlighted?
CACACACACACACACA CACACACACACACACACACACA

Answer 24

simple sequence repeat