molecular1

Question 1

Bacteria use the restriction-modification system to defend themselves from viral attacks (T/F)

Answer 1

True

Question 2

The correct 10-base forward PCR primer starting at position 5 on the following sequence would be

5’ -CGATGTAGGGCGGGATGGAGAGATAGAGAGAGTCACAATATGC -3’

Answer 2

GTAGGGCGGG

Question 3

A drawback for heterogeneous expression of eukaryotic genes in prokaryotic cell is that the proteins are

Answer 3

improperly folded

Question 4

Order the DNA molecules shown below from lowest to highest melting temperature. Only the complementary strands are shown.
TTCCAAGGGCCGGATGGCCT
GGTTCAATAATTGCCTTTAA
AACCTTGGGGTTAACGGAAA

Answer 4

1 GGTTCAATAATTGCCTTTAA
2 AACCTTGGGGTTAACGGAAA
3 TTCCAAGGGCCGGATGGCCT

Question 5

Antibody probes can be used to screen a genomic library to identify specific genomic sequences. (T/F)

Answer 5

False

Question 6

In the laboratory, a new mutant cell line was accidentally produced. It was discovered that this mutant has a deficiency in the enzyme aminoacyl-tRNA synthetase. Which of the following would most likely be observed in this cell line?

Answer 6

Most tRNA molecules would not be charged with amino acids

Question 7

Which of the following is NOT present in eukaryotes?

Answer 7

Shine-Dalgarno sequence

Question 8

In order for an organism to evolve, there may be occasional alterations to its genetic sequence. (T/F)

Answer 8

True

Question 9

Which of the following features is common to DNA, RNA, and proteins?

Answer 9

They are polymers

Question 10

Can you identify a situation that could lead to the creation of a mutant human protein?

Answer 10

change in a sequence in an exon

Question 11

The bonds that connect adenine to thymine in a DNA double helix are __________ bonds.

Answer 11

hydrogen

Question 12

Uracil found in RNA molecules is an example of purine. (T/F)

Answer 12

False

Question 13

All of the following conditions promote the denaturation of DNA EXCEPT

Answer 13

extremely low temperature

Question 14

The overall structure of DNA resembles ______.

Answer 14

a ladder

Question 15

The phosphodiester bonds in a DNA are examples of non-covalent bonds. (T/F)

Answer 15

False

Question 16

Which of the following does not directly affect the migration of the proteins through the SDS-PAGE gel?

Answer 16

the native charge on the protein

Question 17

For an affinity chromatography column, if the tag of an engineered protein is His-tag, what should be ligand to be used in the column?

Answer 17

Nickel ion

Question 18

The DNA fragments greater that 1Mb can be resolved well by electrophoresis in 1% agarose gels. (T/F)

Answer 18

False

Question 19

Nickel affinity chromatography is based on the principle that the metal nickel can be bound with a specific region in a protein. This region is a stretch of _________.

Answer 19

histidines

Question 20

During 2-dimensional gel electrophoresis, each polypeptide migrated based on its molecular mass in the first phase. (T/F)

Answer 20

False

Question 21

tRNA = the _____ molecule

Answer 21

adapter

Question 22

Column Chromatography is used for…

Answer 22

Protein Purification

Question 23

Nuclein = _____ = ______

Answer 23

chromatin, DNA + Protein

Question 24

Griffith looked at avirulent rough and virulent smooth colonies of Strep pneumoniae which determined:

Answer 24

heat killed virulent bacteria can turn avirulent bacteria into virulent.

Question 25

Miescher isolated nuclei from pus (WBC's) to find ____

Answer 25

Nuclein

Question 26

Macleod and McCarty excluded protein and RNA to prove:

Answer 26

DNA is the chemical agent of transformation from avirulent to virulent (in strep pneu)

Question 27

Watson and Crick published

Answer 27

double helix model

Question 28

Hershey and Chase (using phage virus) showed

Answer 28

bacteriophage infection comes from DNA, showing DNA is genetic material

Question 29

Phages only infect _____

Answer 29

bacteria

Question 30

Plasmids are used because

Answer 30

They're small, circular DNA, and can be easily manipulated to better understand DNA.

Question 31

Nucleotides/ DNA are made of:

Answer 31

Nitrogenous bases (ACTG), Phosphoric acid, Deoxyribose sugar

Question 32

RNA is made of:

Answer 32

Nitrogenous bases (ACUG), Phosphoric acid, Ribose sugar

Question 33

Nucleotides ______ phosphoric acid, Nucleosides _____ phosphoric acid

Answer 33

have, lack

Question 34

Carbons in sugars are shown as _____

Answer 34

primed numbers

Question 35

Deoxyribose lacks a _______ group at the TWO position

Answer 35

hydroxyl

Question 36

Purines?

Answer 36

Adenine and guanine.

Question 37

Pyrmidines?

Answer 37

Cytosine, Thymine, Uracil

Question 38

In DNA, Purine always pairs with _______

Answer 38

pyrimidine

Question 39

Nucleotides are nucleosides with a _____ group attached through a ______ bond

Answer 39

phosphate, phosphodiester

Question 40

Define polynucleotides

Answer 40

Chain of nucleotides, made when theres an alpha phosphodiester bond in between. (can be alpha, beta, gamma)

Question 41

Trinucleotides have polarity because of their:

Answer 41

free 5' phosphate group, free 3' hydroxyl group

Question 42

The hydroxyl 3' end can be joined with

Answer 42

triphosphate and DNA polymerase

Question 43

A corresponding DNA strand will be:

Answer 43

antiparallel

Question 44

Rosalind Franklin used ______ to find the helical shape, and repeating pattern

Answer 44

X ray diffraction

Question 45

Chargaff revealed

Answer 45

purines = pyramidine content

Question 46

Watson and Crick stated..

Answer 46

double helix with sugar phosphate backbones on the outside, bases on the inside

Question 47

Curving sides of the ladder represent ____ and ladder rungs are ___

Answer 47

sugar phosphate backbone, base pairs

Question 48

How many base pairs per turn

Answer 48

10 bp

Question 49

What will bind to the large grooves of the helix

Answer 49

transcription factors

Question 50

What does a large groove imply?

Answer 50

More room for different proteins, cell specialization

Question 51

Viruses are ______

Answer 51

packages of genes

Question 52

Viruses have their own metabolic activity (T/F)

Answer 52

False

Question 53

What happens when a virus infects a host cell?

Answer 53

cellular machinery is diverted, and begins to make viral proteins

Question 54

What happens when viral genes are replicated?

Answer 54

Viral genes will be used for making viral proteins, that will turn into virus particles

Question 55

Viruses contain

Answer 55

nucleic acid, some will have DNA genes, some RNA, either DS or SS

Question 56

Why do viruses infect host cell

Answer 56

To use host cell for gene transcription/translation

Question 57

Changes in ______ cause change in DNA structure, leading to ______ forms.

Answer 57

humidity, A (75%) & Z

Question 58

Direction of twist of DNA

Answer 58

Usually right handed

Question 59

High humidity (92%) DNA is called

Answer 59

B form

Question 60

BP in A form are perpendicular to helical axis (t/f)

Answer 60

F

Question 61

A form (75% humidity)

Answer 61

seen when one strand of DNA is hybridized to one of the RNA strands (transcription phase)

Question 62

Changing humidity can change...

Answer 62

Width and number of bases

Question 63

Z form occurs when...

Answer 63

DNA is wound in left handed helix

Question 64

High temperatures lead to...

Answer 64

strand seperation

Question 65

GC % and Tm _____

Answer 65

help identify organism

Question 66

Ratios of _______ are fixed in any organism

Answer 66

G to C and A to T

Question 67

Percentange of GC can range from

Answer 67

22 to 73%

Question 68

G/C, A/T , and GC ratios effect _____

Answer 68

physical properties

Question 69

A/T bps have _ H bonds, G/C have _ H bonds

Answer 69

2, 3

Question 70

Tm and GC are correlated. (T/F)

Answer 70

True

Question 71

What occurs when DNA strands are heated?

Answer 71

noncovalent forces holding together DNA break, and then 2 strands come apart in denaturation or melting.

Question 72

Tm is....

Answer 72

temp that DNA strands are 1/2 denatured

Question 73

__ content means a higher ___

Answer 73

GC, Tm

Question 74

DNA can be denatured by heat as well as...

Answer 74

organic solvents, high pH, low salt

Question 75

DNA density can be effected by __ content, due to large molar volume of __

Answer 75

GC, AT

Question 76

Annealing/ Renaturation meaning

Answer 76

After seperation of 2 strands, they may come back together

Question 77

Annealing factors:

Answer 77

-about 25 deg under Tm -high DNA concentration -increase annealing time

Question 78

Polynucleotide Chain Hybridization

Answer 78

putting together a combination of two different nucleic acids (could be 1 RNA, 1 DNA, or 2 complementary DNA)

Question 79

DNA can hybridize with DNA or RNA (T/F)

Answer 79

true

Question 80

DNA size is expressed by:

Answer 80

-number of bp -m.w. (1bp=660 mw) -length (33.2 A / helical turn of 10.4bp)

Question 81

DNA can be measured using:

Answer 81

Electron microscopy or gel electrophoresis

Question 82

Humans mw, bp, and length

Answer 82

2.3*10^12, 3.2*10^9, 1.1m

Question 83

DNA size predicts how many genes there are (T/F)?

Answer 83

False

Question 84

How much of DNA encodes for proteins?

Answer 84

3-5%. The rest is exons, introns, and regulation of gene expression

Question 85

The average protein is about _____ D, average amino acid __ D, Average protein ____ amino acids. Each amino acid has _ bps

Answer 85

40,000, 110, 364, 3

Question 86

What is the C value?

Answer 86

DNA content per haploid cell

Question 87

C value paradox

Answer 87

more complex organisms wont always have more genes than simple ones- probably because high C values means more non coding DNA

Question 88

Template strand

Answer 88

complementary DNA strand, used to generate mRNA, and used by the promoter

Question 89

Nontemplate strand is not used in RNA transcription (T/F)

Answer 89

True

Question 90

If nontemplate strand is ATG AGT, what is the template strand, and mRNA

Answer 90

template: TAC TCA, mRNA: AUG AGU

Question 91

A protein is....

Answer 91

chain like polymer, full of small subunits called amino acids.

Question 92

DNA has _ different nucleotides

Answer 92

4

Question 93

Proteins have __ different AA's, containing:

Answer 93

amino group, carboxyl group, H atom, and a specific side chain

Question 94

Amino acids are bonded with

Answer 94

Peptide bonds

Question 95

Polypeptide is

Answer 95

chain of amino acids

Question 96

Proteins have 1 or more polypeptides (T/F)

Answer 96

True

Question 97

Polypeptides have polarity because...

Answer 97

they have a free amino group at one end (n term), and free carboxyl group at the other end (c term)

Question 98

A linear order of AA's is...

Answer 98

a proteins primary structure

Question 99

Primary structure interaction leads to...

Answer 99

Secondary structure

Question 100

What are the two types of secondary structure?

Answer 100

alpha helix and beta sheet. each protein will contain both.

Question 101

alpha helix

Answer 101

stabilized by H bonds between the NH and CO groups

Question 102

Beta sheet

Answer 102

made from polypeptide backbones forming H bond, with extended polypeptide chains, pack by H bonding, giving sheet look

Question 103

Tertiary structure

Answer 103

3d shape of a polypeptide, caused by interaction of AA side chains, almost forms sphere

Question 104

Domains are

Answer 104

compact structural region of a protein (ex. immunoglobulin)

Question 105

Domains may have

Answer 105

motifs, like zinc finger (zinc binding domain), and hydrophobic pocket

Question 106

Quartenary structure:

Answer 106

2 or more polypeptides join to make a complex protein (multiple tertiary structures)

Question 107

Protein Functions

Answer 107

provide structure, be hormones, bind/carry, control activity of gene, be enzymes

Question 108

Transcription

Answer 108

directed by enzyme RNA polymerase, enzyme mediated to happen faster, U replaces T

Question 109

Three phases of transcription

Answer 109

initiation, elongation, termination

Question 110

A template can be more than one strand (T/F)

Answer 110

False

Question 111

Transcription starts synthesizing ___stream of the promoter

Answer 111

downstream

Question 112

RNA polymerase

Answer 112

recognizes promoter upstream of gene, binds to it causing strand separation, starts building RNA chain by adding ribonucleotides, and after several are added- RNA polymerase leaves, elongation begins

Question 113

Bubble of separated strands is caused by

Answer 113

movement of polymerase along template. After transcription, strands reform

Question 114

What are the two differences between transcription and DNA replication

Answer 114

-RNA polymerase only makes one RNA strand during transcription, copies only one DNA strand (asymmetrical, semiconservative) -DNA melting is temporary in transcription, but separation is permanent in replication (new DNA will stay hybridized with template)

Question 115

When does RNA dissociate from RNA polymerase

Answer 115

termination

Question 116

Ribosomes are the _________ machines

Answer 116

protein synthesizing

Question 117

Sedimentation coefficient

Answer 117

speed which particles sediment through a soln spun in centrifuge

Question 118

---- and proteins are used for translation

Answer 118

rRNA

Question 119

Ribosomal subunits contain...

Answer 119

rRNA and proteins

Question 120

rRNA's code for proteins (T/F)

Answer 120

False

Question 121

Change from ribosome to protein requires

Answer 121

change from nucleic acid to amino acid

Question 122

Crick said that _____ was needed to bridge translation

Answer 122

adapter

Question 123

tRNA recognizes

Answer 123

RNA and AA's

Question 124

Form of tRNA

Answer 124

top (by acceptor stem) binds amino acid to a certain AA, bottom (by anticodon) is a 3 base that pairs with an mRNA comp 3 base

Question 125

Last sequence of tRNA

Answer 125

cca

Question 126

aminoacyl-tRNA synthetase

Answer 126

brings an AA to the tRNA

Question 127

Complementary sequence of a tRNA codon is

Answer 127

anticodon